Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT42697 chr3R 12435458–12437378 (1920 bp) NPF, CG12783 activityactivityactivityactivityactivityactivity
active
amnioserosa, dorsal ectoderm AISN subset, A-P semi-stripes dorsal VDRC

Annotations

stageannotation termintensity
4-6dorsal ectoderm AISN subset3
4-6A-P semi-stripes dorsal3
4-6amnioserosa AISN subset3
7-8not active0
9-10not active0
11-12not active0
13-14amnioserosa3
15-16amnioserosa4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0027109NPFoverlapping BDGP FlyBase iFly
FBgn0038448CG127831683bp upstream BDGP FlyBase
FBgn0022344CG103403662bp upstream BDGP FlyBase
FBgn0027562CG103454876bp downstream BDGP FlyBase
FBgn0038449CG175625573bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgcgtccgctgattacacagtcatacagtccgacgaacaattgcattgtgacaccgttgcgctttccaatactcaaactcccagttgaaccaggtaagggttttctaacggaacaacacccaggcccgctgccccgtaaatcacttagacacttatggtagatagatatatcaaataatatagtcaaacaatgagctgtcatttagagcaggtatggcaaataaaagcgctttcttagaactattttatgagctctttagtacgaataggccctaaaactgtgattcatagccacatcctttcggtgggcgcaagtcgggtttaactagaggctaagtgccttataattcgcgtaattctcgtaattatcggctttatttgcttattttccgggccgaagtatgagcagcttgcgtcagtcccgcccaaaaatcattgagggaccataagtgacggcagtaagcttgtacgatcacttaaccgagttatagcctagttttagtcaattagcatactagattgcccgctattaagtgaggccctccaaagatccagacccctaaataggtccccgagcgatacgagatctaaattacttaatattggtagttaattctaaggtttttttttaccctgtcatcgattattgtaaatggaaaaacaccatctaattataaacaaacattgttacgctcacgtgttttacttaactattcatttttatcgattctgtaaacaaaaaactattataaattaccatcggtaatatgtgtgtacgtatttggtaaaattataaatcaaaaagactcacagaaaataaccgaagtttattgtgttcgcttttattagctattgctaattttttgcgaccttccctaactttgcgaagtatcgaaatgttagcatgcctttcggattctcatgacaaattactaaaagaacagtgataattaaattaagcttaactgagttaagatattatatagctctataatgatacacaaaacatcctacataaacatacattagccatttatagaactatgtgccaaacaatgcgttgcatcctggttgcctgtgtggcccttgccctcctagccgccggctgccgagtggaggcgtccaactccagacctccgcgaaagaacgatgtcaacactatggctgatgcctacaagttcctgcaggatctggacacctactacggcgacagagcccgcgttcggttcggaaagcgcggatcgctgatggatatcctgaggaatcacgagatggacaacataaatctaggaaaaaatgccaacaatggaggagaatttgtaagcatagaataactgacttttgggcggaaaattatagatttatgttacaggctcgcggttttaatgaggaggagatattctaaatccattttagacgaccatggcaacgtcactaactcatgatgatagttattagcatacgcatttttatttaaattgtttttcggggcaatagtttaacgtgctgggaaagaacaagtagttgcagctacagaaataagtatttactctagtcttgatgtcggttgaataaatgaattaccccaataatcgatgttaatacttaaataaatggtgcaaagatcaaattatggttttcacttcagcaatataaaaaatgaaatatacagcttgctaccttgagtatactacaagtcgctttaatgaaaacccaaagacatgacatacttgcctacttttgggccgcgctttaatttggataacatggctaaagagagcaattacttattacttattacatattccctgaagtcacaatggcaagtacccctccatacaagcggcaactgtaggtaaagcaattagaaatggcataacttatattcaaggatcattggcatcgcatcttactcaagggt

PCR verification status

Line verified as correct.

No slide loaded.