Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT43081 chr3R 13180899–13183083 (2184 bp) beat-IIa, CR44256 activityactivityactivityactivityactivityactivity
active
yolk VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12yolk3
13-14yolk4
15-16yolk3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0038498beat-IIaoverlapping BDGP FlyBase
FBgn0265196CR4425616094bp upstream BDGP FlyBase
FBgn0038499Brf19656bp upstream BDGP FlyBase iFly
FBgn0262871lute24767bp upstream BDGP FlyBase
FBgn0262825CG4319626952bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cacgcccccagtactttcccattttccgcccactcagcgtgcgagtgtgtgctagtgtgcgtgtgtgcctagcaatttcaaaattgttgtgttcaatcagagccgttttgccagagacttccagggacagctcgtcgtcatcaacatctctggagatagtggggaaaattcggggagaaatgcacggagaaagtgagacggagtagagtgtagtcacgttatcgatgcttgagcaaagcttgttgaactgcgagtccggcagttgatgtccaaagttcagattgccggacttttggtctgtttgccatgcaatcgtggggtatgtttgatgtttattagaatctgtgtcggtagctcttcagtggtggtcgcatcccaaaccgatcgaacaggggactttaaaatgttgccacaagtagtggagtttctaatggaggagttgggggaggatggcttaaccaattcattcttttaagaaatcatcgcgagatctttatagactacataccttaaaagaaacgtttatatcatttagaactgcccaacctccgaagttatgtttgaccatatttttgttccattacgtataataataattttcagtgatttttatgcccccaaattgcatttatggcaacataatggtacaaatcccattagtatttcattccaaaatgtatgcacaacccattgacctaaaaacacagtggcactctgtgaaatatacgcaaaggttacacgcaaaatgcataagaaagcaccgaaaactttgtgcataaataagaattgagaaacacggaaaaggataggaagttagggcaaaaaaaaaatgtttgaaaggaggcgaggtcccaggtcaggtcaaagataataataataaaaaaccgctcaaacatgttgccaaaaaaagagaaatgaaaacacaaacaacaagagcaataaagtagaaacaaaagaaaacacaagaaagtgcgaaggaagaaacttgaaatctttcttcttggccgttttcagaattttttattttattttgcgtggagttgagtgagttagcgttggcatttgtcagttgctagctgtcagcgctcacttcctgccacgccccttttcgccaccccctacacccccggggtgtcccctctttttaacctttcgggtaggggcaacccagagagtctgcaacttgccgcaacttttaataaacttggcaagcattttttctttcaaccattttgttccgctggttcaaaggttacgcgcaaacacacacacacccatacacactccctaatttatatagatacgtaaaatggggcaaggaaagggaaagaaaaaaactgtggcaaagggaaagttttacaaccaaactcgaattgaagcagttaaatgccgtattgttttgcaaaatacttgaccgtggagtgagaagttttgaccaacaaattgtcaagttttatgcacggccatttggcgagattttattttgatgtcttctcgtttttcatgcgatttttattgcctccctgcgcgcgttagcgtcttgatcaggaatcagcaaatggaaatggctattgccatccttagggatccttaagcaaagaaccccgaagagaagccacattattattgctgccgcttctgcattagacgctaattagtggcagctacaaaaacaacgcctcgcaaattagtgttgcataactccaggcgctgcaagtgaaatatttgcacatttgcgcaagcaagccaccaagttgttgcagacacatgctcgctggggtgtgtgtgtgtgtccgtcaaacacggcgtgcacacccacaggcagacacattcaatttacactcagagaaacggtgtgcatcgatgcgagtagctatataaaatattctttttgctgcttaataactcgtctcatagaaatacaaatactagcggctaatagtaattattattatttttttaattttggactagagttagtacattttacgctcagtgctgctgtgtgcttagttcctcctgctgatgtggcagccgctgttttggcgtgtgtgtttttgctttgctgcggttgaggctgccaaaactttcaaatgagacccgcgtgtcgttgcaattatgttcaaaatagcattacaccttcaccactatgagaacagtagaacctatttgcaccccaccgttg

PCR verification status

Line verified as correct.

No slide loaded.