Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT43284 chr3R 13567312–13569421 (2109 bp) TyrRII, CG14321 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0038541TyrRIIoverlapping BDGP FlyBase
FBgn0038540CG143217210bp downstream BDGP FlyBase
FBgn0016650Lgr18384bp downstream BDGP FlyBase
FBgn0038542TyrR8539bp upstream BDGP FlyBase
FBgn0038539Atg8b16547bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

caatatgtccgcttggcttttgtttttttccagcatttctctggccatttccgttgcgtttattggcccggcttttataatttcctctttttcaccttcgtttttgttttatatttcgcaggtatctcgccgtcacacaaccactgacgtactccaagaagcgccgatccaagcgactggccctcctcatgattctcgtcgtgtggataactgccctgtcaatcacatgtccaccctatttgggctggtaagttagcgccagctgcacggagaacaaaatcaaccttaacccatgatggatcgcctattcatctgttaagaaaaccattcatgttataatcatttaattgaacgcattaaattgggttgggagtacaggcaacatgtgataatgatcagtatccaaaggaagaaaaataatatatttaatatcatataatattattaataatattatattataaatatggccaagataaatttatttgtagtgctctattaagtttatagatatatatttttttgaattttgtaatattattttcactctttcccgtgtaattcgaaatattatatgtaatatttttattgagcacccattttttttttaccaaatttgtccttccggaggcgtgacaatactttgtggctttttgtggctgaaagtcctgctcgcttttttttttcttttttgagctaatggctgtgcggtggcgcagcatagataatgtgctacaaaagggtctcgaaatacacacgtttatttatattatatttgcgcctttggctgcgcctaaaaaacattacgtaattgacgacgggttgttgctgttgctgctggtcgtgcagccattacattgaagttttaatgagttgttaatgactttgtttgccgcggcgcatttgctttgttctcacctacgcacacacactcagcgcgaaagccgcacacttgtgtgttgcatacttccaggcgcccaaattaaccagcactcactcacacacactcgcactcactcacacacaccacaaagccagcatgtccttaatgccattggccatggcttagttttggccccctttggctgaaagcgaagagcatggcttaaagggcacattaaaacggtctgaggccgaattacagccacagctgcaggacattggaaaatttggaaaatttggcgctgggggaaaatcgcaattataagcgccagcagatggcgccacttacatattttcattctttaagcggactagttttatgaaaaaagtttgcaaatgcagcggttgcaacaactgtttgttttactcacaatctgttatttgttattgcctaatgaatactaaactgattgtgtttgcttgctatttaaatttagatttaacttttggctaattgatttaagcattgtttatttagttcattttttaatttaactaatgcatagctaatgtattaaattgccctcaatttcggattgaataattaatgttaaacaagaagtttagtaggaaaatcggctatttccattcgggtcttgtaaataccaaccttaacaaagttgcatttgtacaattatactgtcaggttattttggtatcgggtagcagtaattaccgtgagtttttggataacacatacttggggtaacaagcagctagtttagttgaattacaacaccggaaaattccattgacagtagtgacaatgaggcaataaactttttgaaagagaaacattataggaaactgtgtatccagtgggcgtgccccaaactttggttggcatatttgtaaaaattggccatccaaaaaataaatcaaaacaactggcaatcattttataatcgtgtgggcgtgagtcttttaggcgattggggggctttagagtgggcgtggtaatgttctgaaataagcttgttcccgagatttggactccgggggacaaatggacataaccgaatcaaggatatatatacttcatgcttctgtctgctacatgatattcagtgaacctagtattctaagaatagtgggtacaataacccagtatgaactggaagaagctgaatcttgccacctacagtggatgtatgtgacaatttgccca

PCR verification status

Line verified as correct.

No slide loaded.