Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT44107 chr3R 15140147–15142388 (2241 bp) Dl, CR44175 activityactivityactivityactivityactivityactivity
active
A-P stripes, ventral ectoderm anlage, procephalic ectoderm anlage VDRC

Annotations

stageannotation termintensity
4-6A-P stripes5
4-6procephalic ectoderm AISN4
7-8ventral ectoderm anlage5
7-8procephalic ectoderm anlage5
9-10head epidermis lateral anlage4
9-10lateral epidermis anlage broad5
9-10ventral epidermis anlage broad5
9-10head epidermis ventral anlage4
9-10head epidermis dorsal anlage4
11-12ventral epidermis primordium broad5
11-12head epidermis ventral primordium broad4
11-12lateral epidermis primordium broad5
11-12head epidermis lateral primordium broad4
13-14brain subset3
15-16ventral epidermis subset2
15-16brain subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0000463Dloverlapping BDGP FlyBase iFly
FBgn0265064CR4417512391bp upstream BDGP FlyBase
FBgn0262262mir-99712529bp upstream BDGP FlyBase
FBgn0262903CR4325815311bp upstream BDGP FlyBase
FBgn0265063CG4417416731bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ccgattaaaaacaaagtggattcacaaaggatttacttctaattactaattctaattacgtttgtcattaagttattaggccagaaataaataaatattcttagtacggtcagtatcaagtttgcagttttctcccagtgcctcagccttcgaacttcagtttcagattcctttgcccagcaggtccggttcctttggctcttggccatttaagttggcctccggctctgggcgaaaacctggcgaaaaggtcgccatgtgcgttgcaccacccctcctccgcccgctgctatatgtaatttatgttaaatgaatataacaaaaaaagagctaaactcgttggcaaaatgctgcggcgtaaactcgctatgcaagtccaagtatgcgggagatcgtcattcagcgcaagaaaaaaaaaaggaggaaaatgaaactaagttgcatacttttaaataatgaaattaatccttgacaggcggcgagactaggaaatctcggtgtgcagaaattgaaattgcaattgccggcggagttggggagttcgaaatgtgctcatggggatggactcggcgatacttgtgtaccgataaagatctattagcctgggaccgcctcggaaattagcctgtagttgaggcggcacagcgggatgccgagtgaaaatcggttaaggagctcccagcaaaacaattaaaattccttgaaggaataggccaagctatatatagaaaaatcgaaaaggaaaaaaaagggcctggcgagacgaaaaacaaagagaacaacatgctagaaattcctatgaaaactccataaatctcgaaagcaaaagaaagtgcaggtagctaagccccaagcaggtagcttctccttctccgcacttcaatcaaattgtgtgggaaaatcagccacaaaaaagtgtttttaaaaatcggagctaaggaattctgctttttgggctgttgaaagaaaaatcgttcggctttgtcaaggatttgtgagctgactagagctggatccttgtgtggtccttatcgctggaagacaatcagttactacacagagattcatgtagcattgtttccaagatggattacacacgatctcggttctctcgatcgttacaatcggaatcgcattggactagtacagcgtttagttcgtgagcccgagcttaattgcacatttcaggcaaatgagggatggccaaacctcaacttcgagcacacttccgttccaaaacaggcagacaacaaaaggcgacaaagtctggccctcgattatcccccatgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtttagctggatggatggttggttggttggatatttaaaaccactcaataccccggaaatcttacactgagcgaagagcagcaaaagctagagcctgccaaggtatcaagttgcgggtctgtgcgatcgcttgccgctttttttgacagctttcgatcacaggaagcaggatgatgagctcataacttttgcccatgtttcaaggaagtaatttcacagcctaaaagatttttgttattgaatatgtattataggttaaacttactgttggtgcgcgcattgccgctgttgttcgtatcatgccaggcctcgacgatcagcgagaaggtaccctgtaaatcggaaagaagaaaaggaaatggttaaagaaagttcaaatctaaacgggaaatgacaggcactaatgccatccacacttatcaaatcgtatcgactataactaattccgagctaatggaaagctccctagagctccatcgcccccacagtgagcactcattataaggagattatgacaggcggctaggcaagttggtcgcccacacgataccccaaacgcccgaatgcctccccggaccgccgaatctaatgcaatgcgaatgcatttcaaatgcaaatcggcaaaatgcaacttcgaatgcaaccggcaggcagcgccctcaattcacacttgatttcaaatgcagcgctgctggaaaaaccggcagagatgacacaaaatccaaatccgaatccaaagcaaggcgaaaaccagccgattgaaacttttgcagaggtgtctctactgctactactgctggctgcagcgcttggttttccatgggtgtgtgttttttcttggcttgcgtagagctacgagtttggagctccgcgtttcgattcgcttgtaaatgactaatttttcgaccaactttcgattttgcgtg

PCR verification status

Line verified as correct.

No slide loaded.