Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT44108 chr3R 15141907–15144017 (2110 bp) Dl, CR44175 activityactivityactivityactivityactivityactivity
active
somatic muscle, head epidermis subset, trunk epidermis subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12somatic muscle primordium2
13-14somatic muscle3
15-16head epidermis subset3
15-16trunk epidermis subset3
15-16outer optic lobe3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0000463Dloverlapping BDGP FlyBase iFly
FBgn0265064CR4417510631bp upstream BDGP FlyBase
FBgn0262262mir-99710769bp upstream BDGP FlyBase
FBgn0262903CR4325813551bp upstream BDGP FlyBase
FBgn0265063CG4417418491bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tccgagctaatggaaagctccctagagctccatcgcccccacagtgagcactcattataaggagattatgacaggcggctaggcaagttggtcgcccacacgataccccaaacgcccgaatgcctccccggaccgccgaatctaatgcaatgcgaatgcatttcaaatgcaaatcggcaaaatgcaacttcgaatgcaaccggcaggcagcgccctcaattcacacttgatttcaaatgcagcgctgctggaaaaaccggcagagatgacacaaaatccaaatccgaatccaaagcaaggcgaaaaccagccgattgaaacttttgcagaggtgtctctactgctactactgctggctgcagcgcttggttttccatgggtgtgtgttttttcttggcttgcgtagagctacgagtttggagctccgcgtttcgattcgcttgtaaatgactaatttttcgaccaactttcgattttgcgtgggcctagggcaaccggagatgtagaattcatttggttgataagccacagttgccgattgattgcataacgattacattgccatttggtttttgtgtgcttgtcgtaatcagacattgaaattgcgctctgcgcgaatctcttctttttgtcgctgcgaataaacgtaaaatttatatgggcacgacaggaagcaaatcagacatagatgatcggctttaaccagcggcatacaatgggaaatgagcaggaaaggtaataacaaacgaatggctaaaatgaaatgaagcgctgcgatggtttattggttttattgtgcagagaaataaagttttcaacagtggctacgtgctggccccgctcgtctgaatgaagtttcccattattatgtgaatttttacaagtccaatttatggagctttagttgaggatctcaagttggatgctattctttagttctggcgaatatttggtgtatgaatctataggaaagtccctctatttcacttcccttagtgggcatatatagcgtataaattgcgagtacctatagacactcgctgcactggcgtatgccacatccaaaaataaatgaggcaacatgcatcagcggccgcttagtgaatatcgcgtgcgtcggtgctgtatatcaacgtcaatatccagcatatagcatacagaatgtagcatagggatatctggatagggtgaagtgcacggcggcaggagtaggagtggtagccagacacgtagcaacagccacagggggactgactgactctcagaagacacagcccgaagacccaatactcaagaccgaagacgcaagacgcaaggcacaagacaagacagtacagcccgtcagacgggggacaaaagtagcaaagttcaatacgaacaagaggagcatgaatgctgcctgccatcgcttgactatttttagtcgctgggcgggcgaagggcggaaagggggagtggcagccccctatccctacatgcaacatcggttgctatatcttctggcgtgtcgtcaggcatgcgtggctcgtctttcgttgttttaattaagtgcaacattaaattagttggtgcagcagcggcagcagacagagtcatactataattaaatttatagtttgacctagaaatgttttgaagttgaaagtgcgcggaaacggaccgaaataaagtctagaacgctctaggagcaccgattgaaacagcaaactaattttagagggcaaaacaaaggattgaagttcttgccccagtaaagataaaatagatcacaagaagcaatttaccaaaataaagtctagcattttcttgaaaagtctaaaaataaaaaacactccaaaaaacattgacgatagaatgcgacgtgaatttcccttttcactatatttaacttataccgaagatcaacaatttggcgcgtgcgttttaacttaattatgctagcccatagttcgctaattgtttatttatgcctgcccgcagcttaatcgctaaaaatgtattcagcttacacatttcacgtgccaaaacatctttcgctacctggcccggtggtaatagccccctccccaccctttccctagcttcctccccctttttcggaccatgacttt

PCR verification status

Line verified as correct.

No slide loaded.