Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT4435 chr2L 8814596–8816711 (2115 bp) SoxN, CG42710 activityactivityactivityactivityactivityactivity
active
ventral nerve cord subset, brain subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16ventral nerve cord subset2
15-16brain subset1

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0029123SoxN11049bp upstream BDGP FlyBase iFly
FBgn0261627CG4271032097bp downstream BDGP FlyBase
FBgn0032069CG946833345bp downstream BDGP FlyBase
FBgn0032068CG946638334bp downstream BDGP FlyBase
FBgn0032067CG946542253bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgcaactcaacaggactcgggataagttgctggtagttcgtaattattttttcattttccaaccatgaaatcgatgcaaagtaaaccaatcccagtcgaacgaaattggctccacgccactgcttgttttagcccctccctgtaattagctgagcaactgggctttaatcaagcagaaaattggaacgcttcggttctggcaattagaagtggtcaaatgcaaagcacaaatagtggcagcagcagcgaaatgcgagcaaagtatatattccagcacaaattgtagctcacaaaacacaaagttaccgctccgaatggcaaacaaaacaaatgccgagctcagcgcaaatttcatcagcctgccgaacttttgcctttgttcgaggtggattattggtggtgtcaattgccagtggccatttcaattctgttcttttttctccctttttattttatacatatttttttttggtaatttacgccctcgtcctgggatccttggcatctccaccgccatctgctccaccattcccactttaacgagtaatttcaagtttcaagactctggccgcctttgaatgcaaatgctgatgatgcatttcctttcagtcggatgccgaaactgctgagagcagcagattggaaatggctcctacaagatgcatatacatatacccgtactcatccatattggctgtgccgcacgtacatatatatccgatttgtattatttgtcttgcaagttaattgaataaaatgccaaatggcgaatggcgaatggtggaatccaagtgcgacaaattcagctgccctggctttttattttagagacattccgtttcattgaccgacgtggagcgacgacaacgacaaattgtcagccatattaataacatccccgaggtggagcacagtccacacccgagtcattgttcccatggccaagcggagctctcattgtccgcactttcagttacttgtaacagcatttcaatggcgacgacagcggcttgcttattacttgtaactcgcagactgctcgcagaaggcaccgcagcagcatccatagtccccatctctaccttcatctccatccagatccactcccgatccccctgtaatccaggtccagccaaaggaataccacatgctctgcggtcagcaagttctttgttccctccaagtgcgtgctcgcatctgaaaggcggagaagtacgagtgctacagtcatctatccacattgaatgcccatttacagtggcccttgaatctgaatgccattcccagctaggatgtacgaatcaaacttggtttataagctgttgtatttacccactaataaagtatatcactatgatagctttatatattttaaaaaatattttttaaaccacatgaacgctttagagaaacacctttctatccgaattctttccatagttcggatgacccctgcctaatttatgtttgactaatctcacactcagccagtccagttttagtccgccccaggtcgaacaagatccagctattcgactgtccgataacgaagattctcataatttatgccccaatcactgtccacttttgtttgcctccccgaaaggaattgggagttggattttggtgtgtggtggtggcgtgaagttgcctaattatgaattaatttcctaagatattagcaaaatatttgaatttctcgggagtaatttattacggccattaggagctctttctgatgcgcttggttttttcttgtcttggactgctcaaagtgttttaaaagaatttctcggctcgttattctcgtattttattttcagtgaataaagacataagcgaaattattaatatgtgtcgccatgtggcagccaaatgaattcatagttcattgatattaatataaatttatcgcagaggagatatttgaatttttctatctcgagtttggttcgtgttgaaaacaattaatgtgacaggctctcccatatcattggatatttattggaagctaacttcatactttttgcatttttaatcacaacctctgtctaagttatgcgaaatcttcgaatatccactggcccatcggtgtgtacataagtttccagtccaa

PCR verification status

Line verified as correct.

No slide loaded.