Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT4442 chr2L 8831294–8833463 (2169 bp) SoxN, CG32986 activityactivityactivityactivityactivityactivity
active
procephalic ectoderm AISN, head epidermis lateral anlage, head mesoderm anlage VDRC

Annotations

stageannotation termintensity
4-6procephalic ectoderm AISN4
4-6ventral ectoderm AISN2
7-8head epidermis lateral anlage4
7-8head mesoderm anlage4
9-10head mesoderm anlage4
9-10plasmatocytes anlage4
11-12head subset3
11-12hemocyte3
11-12ventral nerve cord primordium subset3
11-12plasmatocytes anlage3
11-12head mesoderm primordium3
13-14head subset2
13-14lateral epidermis subset3
13-14ventral nerve cord subset1
13-14telson subset2
13-14brain subset3
15-16head subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0029123SoxN1625bp downstream BDGP FlyBase iFly
FBgn0052986CG3298631482bp upstream BDGP FlyBase
FBgn0052987CG3298732517bp upstream BDGP FlyBase
FBgn0052988CG3298833570bp upstream BDGP FlyBase
FBgn0052983CG3298334556bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgctttccgttttattcgaatgttatttctccgactaattttttgtggcgctgtcatttgttgcaatcagtgagaaaattaaacgaaatcccgatgacaacatttttattgctgctcgcttgccattaaaattaggagctaatcacacgtttaacaagatttttttgttgtgtgtttgtttattcggtggtttctgacttcgatcagttgatattttattttattttttgttgcctttatagtggggacagcagacaggtgcttagcttattttatttttttggctgcatctgagtcagcaatcgccgatcgtgagagtttttcgttggctttgttttggatcttttgatttagttcattaattggccataatagttttgttttataacagggtatacatcggtggtgaacttgaaatccattacaaactggttgaaattgtcgtcaagtgttagcttatttcattttgaacagtaagctttggaataaaatatccataagtatactctgtgatgttccctaatcagatgtatctaagcttactctctctttcttcgggggacttcaacttcaacccttcaattgtggcaacaaaagctttgcaaatgtcagaaagagacgacggatgggatgcagagatagatggatagagttgaacaactaattaaacttgaacaatggcgtaaagttggcaaacaaatgtcattacttcgactccagtctggtcagtaagtagtagtagactctgagttgctcgagttttcggtttgcgctgctggttgacacattttctggaatgtaggttaaccgagtgagacatgcaacgaaatcgagtggattcgtaagcctaaaactgtaaccaattcggagacggccctttttctacacacattttttcggctacatttccgagatgcgagtacataaacaaatcggattagttgacaaaaatccaattagccgtgagccccaaacccaaaacggttgaccattttcaactggcagtggacgtaaaaataactcgagcatttgatggatgtgtggcaggcgtaagaatttatagagccgtgatttgatcgataggcccgatgatttacgaggcaggtactggtgctggtaaatggtacaggtaaatctctggggggtgcaacataccatacatgcaaatttttaaattctcagactgcctggcgaccccggagataagctgacatcccgtacacctgcaccggaaaacgggaaaacccatccaccattggcaggtcgatgctcatacctgtgagcacggataatgaacctctaaaatccacgcctcgcaaatcctcaagcggatgctcggatccgcatcctggcactcatcctcgtttttgggcaataaagggctaaacaaacaggcacgacaataagtccctatagatcgcagtgcatattatcataatcaccaataaaaccctagtcgcaaactaatccacagcaacccatttcgaaccttcggttgcattcagggatttgcggtacacaagtacaactccgaaaagtttatcggcataatactgcatacttgctttcggtatctcaacgattcttgatatttctcgacctccacccgcattttcgcctagtgtaattcaatcacagaacgcgttcttcccgggcaatgaacgcctgcataaaatgcgcaatctgaatcccatggggccattggctaatcgctgtctaattataattttgcatttttatcgctaagggtctgggcatttttgggagttagggagcgaggagggaggggccggcaaggccgttctgtttcggatgcggtttgttttgcaattaggcgattagtcacgccctgatttgtcattgatactccgttcgctcgattgctcagtttgtgctgagtgttatgtggcagtactagatggaaccgaggccctgtaactacatacatatgtatataaactatgcgggctggcttagtggtacatttgacatgggggcggggtaaaatatgcagataacaggaagggaacatgatatgcgatgccagaggaagggtccgtctttggtggtttcacgttttgggagatcatatcgaagtatctgcataatatcagattattgtaaaatacgactatcacttaaccgaaaaattctatgcaaattcgaaatg

PCR verification status

Line verified as correct.

No slide loaded.