Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT44959 chr3R 16746429–16748737 (2308 bp) CG31191, CG5630 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051191CG31191overlapping BDGP FlyBase
FBgn0038842CG5630overlapping BDGP FlyBase
FBgn0263460snoRNA:CG31191-a7829bp downstream BDGP FlyBase
FBgn0264915CR441067839bp downstream BDGP FlyBase
FBgn0038840CG562112445bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gcaccagctcttccagaccataaccacctagtgcttgcagactggcacttgttgtgcttttaacatgttgatattgttttcctggccacccaagctccacccattccctttgatcccacctcctcctcttcctcctcctgctattgcccgtaattttcgcaattttcgtttgcggctcgtgccgctgtcacatggcaaatctcgaatgtcgggcatctggaatgaagttaagttaccatgaatgtgtcagccagtctgtttttgtttcccctcgttattgtgcctgtttgttgccatcagctaggaccaaccagaacatacaggacaaagcccaatgacagttggtatacatgctgcactggccatcctttgtgcgccgacttccctgatgtacgttgaaagacccggctaccttgataagtaagttccgaggcgtaccaacatcaaccagaccactcaaatcccttgaatcgggccgaaggtgaagccaattgacatttctcgatgcaactgatcactgaaacgtgtctatagtatgtatcctccttcaaatcggccagatgttttatagaaaaatattgcaatgtactgcctacatttcgacccggaatgagcaacaaaaacctgacagaaatggggaaaaacattttccacttgcattgttttccactggtggttgatgatgccccactttgctctgtgtgtgtgtcagtgtgtagtgtgcgtgccgcataaatttcattttgaacaataataagaaaagttggctgtcgttggcctgcagggcaggcttccagtcagatcaaaatcacaaacggcaacaatggtggtgttttttgtgtgtgcattaaataacaaaaacaccgaaacaaaagtttggtgaggaagacaaaaaaaaacagagagcgaaaaaagcgggcgacggctggccagggccatgttacgtatacgcaccattgagcggccaaatcgcattacgcattcgccatgtggtcggtgcaaccttaattacaatccccttgcattcgaacagcaggagtgacccacattgatctcacatcgaccggaacatcacaattatgcagtatgcttcgaattggattgctttcatgtggatgccaccacctgacggcatttgcattctgttggcgttgcatctacgtgcctcgccgtgatgtgtgacactttgacacatgaatagtgctagggatacgcccaggataactctgtcttcgcctctgtggcgacgtcatgctctaagccaattaggtggaacaaaggcaaccacatctaacgccatcgccacgtgttgctctggcataaacaatttatgagcgaattctttcgaagaaaataccatcagggcaaaccgcaaacactcggtacgcacaaaaagtattaaaaaacttaataatcattatatttgcagagggggatttactcacaattttttgctgatcattagcatcggcgtcatgatgagcgtaccaagaaaaaagccaagccgtttattgcgtatttttaggtcagagcaaacagtggactcaatatggcacgaggccagtcccgattgaagcatcttcttacctcgctgcatgttttccccactgtgtttgcctttaatcgcatctgcaatgagttttccgactttgatgagtttgtgcttgctcgcccagggccagcaaccgaatttccatatcaattagcagccctggctccgatcgaacatttccggatgtttgcgcagccccaccgctaaagtataccctatctatatctatatttgagtaaataaaaaactaatgaaatccgattttccgtgccactttatggctttgcccgctattcagttactggtcagcaaaacaaagtatcgaaaggaggaggccacggaacatgttgcttctacgacactgggcagtaaaattttgggcttttccctgtccaaggaaattgatttttttcatagagattgcttatcaataaactacgtttacgagtccataaaaattcatttttgtgtttaggaccgaatatgttttaaacgtgagcctaataagaagaactcgggaataatgtatggaagcatctaagaatgtctatatatcaccgtcaagatatatattttttgtaaaaattgtcttttgtagtcaatttactctgtaattacaattttttaaaatattaagataagaaatatagttaacttgaaatgaatgtgaaattctaaaacatatcttttgccgcctaaaatcttctaaaatattttcgtggttttgaactctctctgttgttggccagtgcaatcg

PCR verification status

Line verified as correct.

No slide loaded.