Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT44966 chr3R 16758277–16760610 (2333 bp) CG31191, CG5630 activityactivityactivityactivityactivityactivity
weak
ventral nerve cord subset, brain subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14ventral nerve cord subset1
15-16ventral nerve cord subset1
15-16brain subset1

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051191CG31191overlapping BDGP FlyBase
FBgn0038842CG56303343bp downstream BDGP FlyBase
FBgn0002921Atpalpha16159bp upstream BDGP FlyBase
FBgn0263460snoRNA:CG31191-a19677bp downstream BDGP FlyBase
FBgn0264915CR4410619687bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgctaatgacttctaaatggcttgtgaaatcgaaaaaaaaatatttgtcatcataaaatctagtgagctaaagcttcagtatataatccaatgtaaaatcaataattatcaatttgaaaacacttaagataattattttatgattgggacttcataactatatttaaagtttatctaaaagtttagaaaatgtacaatacaaactttgaatagcttaaaatagggtacataaaagtattgattttaatgtatggaaaccttagtgttgaacctgtcactttgtttgatatatgttttcaatgaaaatgcggaatggaactgcactagatcggttttcaggcacaagctccttttcgtcctgcagatgttgcgtgtaatcggcctccatgtgaattaccataacacgacaccagaaaagaacacaaaaagcagcatacacacagatacgccacacagatatgcacacagacacacacacacacacgtgcccagggatatccgtgtgccagttcgaatgaatctcagttcgcacttggccaactgaagcgtagacaagcagctctttaagtttaagctagacttctgccccgccacccgtttgttaaaggaacggattaaggcgtcaaaatgttagacaagttcctggcccgactctgctcctgattcgcccgtggatagatcaaagtcccgcgctgcatatacatatatatatccaatagatgaatacatacacactgcgatgtatggaaggtccttctgcgtacgtgtgtgtctgtgtctgtgtgtgtgttgtgaactgcgacgtggcttaagcccacagccctgacaatgccttttaatcaattccccaagtcggtccatcaataagcgacggcgaagggcccggaaaatgcgagtttcctttccggctgcctgcgcgtgctttccttttatttctgccattcggcatttttcttgttgtttgcccggcatatgtatgtcaatttttctaatgagctagcaaaaataagtaaagttagggccttttctgcatttcgatttaaagctctttgaagaattctcattttattctctcgattgaaatattattttctttttttcgctggggacatcaaagtattttaatcaaattcaatacacaaatggttcaatctgatcaaatttattttaagatatttctaatataatttaataaattcttggcaacaagttagcttatgaatgaaagtgaaattaatttcacttgccatatggatttctttggagataaacccatgaaacaaatatataagattgtgctacattatttttaacaatttctgcatttaatctttcacttaataggtgacttaaattaagctttaaaattgagtcactacaatattctataaatataaaaatattagtgtgggctatctctgctatttgaatatgtgcgtaattagctaatatccatttcatattagctttttataaaataaatacattgtggaatatagttggctctcataaatgattattaattttaattttcagtattcatttatttagaaatgtataattaaaacagattattatacaaaaagagctgaatatttatgaatgacatatttcttgtttggaaattaatgctgttatctatgccttattaaattgttagaaaagaaaacttctacatcaacgtgtgatataagttttaaagtggactattagtattgcaaagttggaaatgtgtaattaacagcattttcacttaattactttaaagcagttttgaaatggctcttacctacgaagtcctacgattgggttatgcaattttcctaatgagttggcacagataaacaaacaaactcggacccgtgcttgcatttaagtttaaagtccgtttaatgccgagtggggggggggtgtcccagttatggagcgcactgtacacctgactgaccacacaccacaccctcacccctccctcacactgacaacctgaaagccaggtaaaccaggtttgttgcctgtgcattaaatttgatggctgcaagtcctcagctcataatcacaagcagtctcccacctgcgaaaatggaatttaatttgctaatacgcttcgttgagtggcaaagggaggcgttttagcggggtttcggggtttgaattgaagttagtcaggtgagacaggttgactatgatgggtttttgggactggcgcttttttgttgcgcctgcgggagaaattgttgaaaatactttgcaaatcgttgctccatcccatggcccagactttagtaattctcggctgaaaacttggctttcgcatagttgagctggtctcgg

PCR verification status

Line verified as correct.

No slide loaded.