Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT45317 chr3R 17442967–17445048 (2081 bp) InR, CR44034 activityactivityactivityactivityactivityactivity
weak
brain broad, ventral nerve cord broad VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16brain broad1
15-16ventral nerve cord broad1

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0013984InRoverlapping BDGP FlyBase iFly
FBgn0264826CR440341506bp downstream BDGP FlyBase
FBgn0011766E2f3059bp upstream BDGP FlyBase iFly
FBgn0262405mir-9984634bp upstream BDGP FlyBase
FBgn0262434mir-115252bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cccacatttccccattttccaccttcccgcccacaaaaccacttacccgtaatatctccacgccagttatttgggaaatatcttcccatttatcactatttcagtacacccacagacccccgatctattgatctgcttccgttgcggatacaacacaaaatcaaaagcccgtaaatcgtgggtgtatctttatctcgttcttttaaagggatatcccacttttaatgtcaacttaagtcattaaagtctcaacctgcttaagttggcattaaataattaatgtttataaaatgaaaacattgtagaagctccaaacgtttttacaaagtctccattaaactaaatttaatggatatcttatacatataccttaaagataaaaagaaacccgatttataaggtcacagtttgagcaaatagtttgatcaactttttgggatttgttttagcaagtgagagctttaaaattgtactggatatatttggctggtttactcagcattttggtcactctaattacgagctccaaaataaaataaaaaacagcactgtcatgactttttgacaaccgctgaaagtgtggtgtccaccatacattaaaaaacaacacattttccaaagtataactttagaattataaaggtttgaaaatcatgacaagtcaacaggtgagttcaattttatttttgaaatattaaataaaaaattgagttttgcaggtggtcctgaagagggggtgagagcaacatacatattaaagcgccttttaaggaaaaatgtatgggtgtttaatggaagtcgactaagacacttctttgaagtttattgttttgttttttttaataatttatactaattctataaatatttaataaaattctattgaatagctcttattgacgcttgtatgattaattttaaaacttaccaaggacaataaggagacagtctttagcaatagtactaagtaatttcatgaaatactatttttaataataatgttagttactcttttagtgctggcttaatttaatgcaatggaaaacttatctgtaccacttttcaaaatgcgtgcaacaataaaaaataaaccagcacaacaacaacaacaataataaaacaaaaaccggcagcaatcgaaattctttcatttcttttccgcctctcttcgcgcagccgctctccgcacgacagagagacagagagagagagaaaaagagaacaatgttggctgcgccgctcattcacaaaacggagacgtaaagcggtgtgcgaagaagaagaacaacaacagcccaagatatgatagatatggaacaacaacaaaaggaacaagaggaaccgggcggagagaggaggaggaggagagcaaaaacaacttggcataaattgctgctgcgtagtaatttcacgagtattttcctagttacgttctcactactattattcattttattattatttgttgtttttgttacatacccctttgcaacggttttgttgtcgtgcattgttgatctagttgttgttgtgtcacctaatttttgatttttatttctatttgtattttattttggtatcgatttcaaaatagaacgacgcactttcccagacgcaggcgtaattaaattttcttatgttttattcgcgtgctttctttttgcgccgcaacttcacaacatgctgtgtatatataaataataggagagcgcgcgtgtgtgtgtgtatgtgtgtgtacacaaattttatttatttatttaccgtgaattttactcacacacccggacaagccgcactctcgccagcacacgagaatcgcccgcacttgtatttcgtggaatttctttaattcgaactccaccgacctcgcactattgctctgtattttgtattttcgcacttttcattcacgaaatgctggggcacataatttcgccttgcacagtattaggtatcggcaattcactgtggcctctatttgacagcgatgattttccgcacgacgaacacactcacaattccaattcacggcgaccgcggcaacgatctcaacgtttcgaaatcgcgtgaaacactgccagc

PCR verification status

Line verified as correct.

No slide loaded.