Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT47418 chr3R 21475909–21478909 (3000 bp) jigr1, mir-92b activityactivityactivityactivityactivityactivity
active
ventral nerve cord subset, ventral nerve cord primordium subset, brain primordium subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12brain primordium subset1
11-12ventral nerve cord primordium subset2
13-14ventral nerve cord subset3
13-14brain subset1
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0039350jigr1overlapping BDGP FlyBase
FBgn0262388mir-92b1211bp upstream BDGP FlyBase
FBgn0027508Tnks2904bp upstream BDGP FlyBase
FBgn0262411mir-92a3588bp downstream BDGP FlyBase
FBgn0261986RASSF811608bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ctcgcagtaaccggggtggaagatccaagcatttcatttattaacataatggaaaaatacacttatttgctttgttttaaaggcaggggaacgggtcgactaatccaaattgattaattttcagattcggcaagagcataatactctatctgtaagatgcacatctgtaatggtatagaatcctataaatcctacataaaggaccatacatattttaaacaataattcacttcatggtttcattaaggcgtcaactgaaatgcaaatatacattatgtatataagtctgtgggatcagacgcaattatgacttcgccacgaatgtgagcgtctttcagtcagcgttccccttgcgcaactcggacctctataagggccatcattatcttacacaatagtaatctgcccctttaaggggcatatacatatttccatttcccttggcagacttaaagcaaacaaaaaggtccttaagttttattactttctgtatgcgagaaccaaccctaaagcttctgaaagcttccaccttcggcccttgaagctaaactttgattactatcccaaggaaatagtttcactgaggaagagctattcaagccagttgaactgtaggccatgaataatgcaatggatagctgaccatgctaataaactatctaccacctaattttacgcccgtcttaaaggccacccagaatcactggaggtgtttccacgtagattgctgatcgatgttgtgggacgtccaacgcaccatcattcccatcccgggatatggcgagaaaatatgtgccgggaaaactggaacctgcagtcggaattgccggcacagccgaatgcctaatgccaaatgaagtctgagtaggcacatctccatttgaccaaactgggtggggcctccaggccatttctatgtgcgttgcccccttgtttactcctttttctttaataatgcgtctatatttcttaattaaattacagcttctcgcatttgggagtgagtgtgtgtatgtgtgtgtaattacagtgtttatgtggcactcggacattcctggctcctctcttccttttcccagctggagttggctgacttggcgtattgataaggcccaggcccacaaaaggaacgcgaaaggtgagtggtatggggattgggcagtttggagtttggagcggattgcatccgagatgtgagtgcagtggtacattaaaacgtcacctgatgtaggccgtgcccagtgcttatttgttgcattttcgaaatacaaattgcactagtcccggcctgcaatgagtgtcgcagtcgacgatctacacagtgcaaaataatttgtaaaaataattaaaaataataacttcatagatttttttattaaattagtttttgtgtgggatctaatcactaatcttgcaacaaatttataaaacgatctacaaacatatcaatgttgatcgtatcagctccaaaatgacgcccatttttttcggtgctgcgagcagcttgccattaagcctaactttaacttaatgctaaccaccatggccataatgtggtgcggttgtgctgcgttttgcgtgctgctgttcgtcaaagtcaggaccgtgttgccgtctactcatcttgccatctcgaatgtctggccctgtaattatataatttaatcaaattacttgcatatgttgccaaaaaataaaaaaaataagagaaggaaatgccaaaaaactaaggcccgaaaaagagacgcactggagcgggccgaaagacttgagaaatggccaaatgcgggccaacataagtggcaagagaaatgaaaataaaaataaatgcttgcgacagcagctcctggcggctccaaaatggtttatagccgcatttttgacagtgaaatgtgcctgcgtgcgttttctgcagcggtaaaagaggaaatcgggagggggaaagagagatatttgcgtactttagcattcatcatcattattcttccgttgcggttgcattttaaacttttaggcgcagcttaacgtgtcggtcgacttgacagttgcaaattgcaagcacatctgctggcggtcaaaagctagctgctacgcacgcaatagtcgttacgacgaagctttcgttaccctctattgggttcaaagttaatcacctaatagttttcccaaagtagcgttactaaaggaaaaagagagagcttaagataatgaaatgacagtaagctttaacattgagcgacataatcgttaggatggagctttcgttactaactactttgatcaaagctaataaactaatattgaagccaaagtagcctttacttaatgaaatatgaagatggtttaaattagcattctaaaatgaaataaaataaatacagtgtagataaggctctataatatacattttagaatgtgtttactaaaagtatgataacgaaaaaaaaacattgtttaagatttttatattgcgtttatagatgtaaaaattaatttgggttacataggtgaagagttcatctctcatccaattctcaagcaatcataaatgcaaaattcattttaaaacaaagtgtagtgactgaaattgttcaactaaaagttcaatgtcaagcagattgctagtttcaaaattaataaacatatgcctacgtatttatacatcactaccatgactgggagtcattctccatatggccggattataaatagaataccgcatatagtttttgacccttgctcttcactgattgccttctgaaaatgttaaggcgccattttagtgaaccaattgtacttattattaaatttataataaatattcaaaacaaatgaattccggttatgagacatatgaaataacccgcataatatattgcttaaaaagaaaaaaaaaacatttttcgattgatgtatatgtatttgtatatttaaatttaattggagttttaattattgtttaaattaactaagcttaaacacttaaataaacgcgcgagcg

PCR verification status

Line verified as correct.

No slide loaded.