Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT48345 chr3R 23261709–23263840 (2131 bp) side, CG44290 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0016061sideoverlapping BDGP FlyBase iFly
FBgn0265317CG442902884bp upstream BDGP FlyBase
FBgn0263401CG434474325bp upstream BDGP FlyBase
FBgn0039518CG1397828202bp upstream BDGP FlyBase
FBgn0039519Cyp6a1842688bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gaccatcacaacagcattccactcaaagatgaaaatttgaaaggcaaacaaatctgtcccataagcaaaccccggctgtctgtggatcctggctagctggctgggatctggatgggatgggatgcaatggaatggcattgcgaattgaaggcgcagcttccggagcacggacttatggctacaaatcagaaggaccaacttacccccggctgctctttggctttccctggctagctaatccaaaggacagaggaactttcaaggccttccaactggcaagtttaatttatgtttttgcttggccaacagatagagagcaaaacttttgctgctcgcagctattgttccaatgcactgacccgtatttgcaaagatgtctgcataagcaatttgtatcttgtatctactatctttgtatcttgcggatgctccgatgcactttcactttgccccgccagacgatggcaattgtgataaattatatgccacgcgaccgatcggattggatcgtttcatatcagatgggaatcataatcaaaaccgaagggggcaggctgtacggccgacgaactgttgcgcccactctcacacacacacacactgatatactcatatatatactgaccactacaaatgaaaccgcagtgtgttattgtgtcattaatttgtgcgctctctttgtgtgggaatactcctttttattgctgctttttttggcgcttaaagtgcgaaaactgactggaattaattgatgatccgcacgcagctggagtgcggtattggtattgttggttgattgggaaatggaaaatcgaaaatgggaaatcgttaatgaggcagagtgacgcgttcacatttccatatgatttaatgatttacttcgggggtccttctatctgctctactacgcacttttacgaattttccgcaactcacttttcagtcttgctgtttgtttgcccgcacttggagtttcattttcattcgcattttccgctttcggctgttattgctgctcgtaatccgcttttgccctaaatttcgatttcctttcgcttttttttttgcactgcagttatttcgaacttcgctttttccagttctcttcaagtgttttgataacttgagtgtattattatttttccggcacgttgtgttaattcgtttcttctttttttttcgttgttgtcgttgttgtttctggtgggcggtaggggcgcggcacacgaaacgtaaacgatgcgcagcacttacggcgctcgagagtcacgcacaaatggtccgccgccgcctcctattcctctaattagccacataaattgcaagttggccagggccaaaagaattcaaaacacactgtctagagaatcgcaatccctgctgagtagtggtggcaatagtggcaagcgccagcaatggcacagatatatgtagccaaacacgctatcgatatatagagcagcacccgcacgacgaaccaaacgctgtgagccacggataagaactaaacaacattcgcagctgccgctgctcggctgctgctgctgctgctgctgcatgttgttgctgccgctcgttgctgctcgctgctgctgctacggggtagcaacacatgccgcatatcattcacgatttttcacttcggacggcgacgagcttcggatcacgagtcctgccgcgctctctcgtgccgcatgttgctcgtgcgagtcctcgtgcaacatgcggccaggacgtgacctttggcaactggtcgagtgttgttttggctctcgggcgcgcttgcagccaattaatgggccactcgccatgtgatttattggcaccgctcataagtccccccccctctttgcccagacaggataaacaaaaaacacatgcataatttccataaatcttttatggctgcgtgtaaaaactttcggctgggccaattatgcggaccgaactaggcactaatttgacagcaaagtgcccaaaaggctttatccctccttgggggtcagcctaggtcaactctggccaccctccactccgccgtcgttcgaatcgtgtccataacttaccacataattgagttatcccccggttaggggcatgaacaagcttttgttgtcgtcctggcgaaggat

PCR verification status

Line verified as correct.

No slide loaded.