Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT48569 chr3R 23713551–23715715 (2164 bp) CG34353, CG12426 activityactivityactivityactivityactivityactivity
active
posterior endoderm anlage, A-P semi-stripes dorsal, A-P semi-stripes ventral VDRC

Annotations

stageannotation termintensity
4-6A-P semi-stripes dorsal2
4-6A-P semi-stripes ventral2
7-8posterior endoderm anlage3
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0085382CG34353overlapping BDGP FlyBase
FBgn0039552CG1242615440bp downstream BDGP FlyBase
FBgn0039553hanabi24618bp upstream BDGP FlyBase
FBgn0039554CG500325948bp upstream BDGP FlyBase
FBgn0039555mRpS2229079bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tcaaaatgcaaactgtcaaaatggagctgttggaaaatatgaaaaaaaagaaacaaaatataaaagcaaacagctagtaacaaatgaattagccatatctatgcgcctagtgtgtgtgagtgacggcgtgataacgcgttattacactataaaatcattaatatggcggctctaatgtcgaggatatgtaaatgcaggcgctgtcacgcgaaacgcttataaaaaaaatataaaaaaaagtatagacaacgagccctgaaatgcggcattagctgcctatagacgagatccattgacaacgcctaccatttgagcccattacccaacactttggcaataaagtcgagtgtgtgccccagtgccaaggcaacgaaatctattagtttgccaaggcttggcgggaattccagcagaagaagaggtggaagagctgcgacaattccgtaaatttgatatgcgcaatttgttgcgaggacgaaggaccaaggaccaaggacgaaggacgaagcagcctggcaacctgttgccgcttgttacgcacttttatgacgccagcgggtgggcttcgagtggattgcgtgtgtgtctcagcccaaccccggtagaaacaacctcaaagtagtccccattaaaggtaatatgccacatgagtcgctgatggaactcactcacattccttctgcggattgccataacatattcacagggaagttattctgaggactcgagaattcggtcgtagacccctcaatattctgattcataaccttaataaaggggtcgtagaaagatctagtttgctccactatatttcaacaaggtggaatagccccatttttcactgcatactttttgacacctagtgagtaattgaatgttttaaatgggttatcaactttccagttatttcaactatgaaatttaatttaaagaacgcatttaaagtagtctaaatccttgctaagatgagatctcaaaatttaagctagaaatttctcagaaagtgcgctatgcttatttcatattgtgctgctgttcattgcagtttagcatttgatatgcagaaaaaaaaaagtgcataagtttttttccaaggctccgatatacttatagtttatactttggcaaatctcagttcaagacaaaagtaaccaactcaacttggaaactttcctctttttttgtgctatttcagttgcagcttttggcatttcttatgcagctgattgcatttggccaagagcaaattgcagcaagagcagcacaaggaaaatgcagctgcaattgaattttataacaaacaattttacgctttaagcacactagaatttgcttttgttgtagctagctaccaatgaggctgctgccttgaagtggccggagtgcgtcattgactttgcctctggccgaagtcacttttccactcttcttttttcctatttatcgttatttaccattagctggctttcacctacctctctccccaccccccacctcccatcccctcgaccctttcgcctgcagcaaggacctgactttcctcggactcagtaacggccacacaataagcattctggcccagctactcgggctcgcctttatttcctgcggcttccccttttgcagccttgagggtaatcgctgcccataagcaggcacaaagtttaataaaaaatagcagaacaaaaacgaaatcaattcacctagccaggcaattatgcagcagcaagttgagaaagtaaaaaacttagtcaaatggttctcaattaagttaagtttcggctacagcaaagcaatatagctgaatggctagacaagtttgagaaacaaatgtccaagccgatgaatgttagtataaaaaatttataaagttgaataataatccctttccttaagtaatacttttttttataattttattgttttaatgtaagcatttctgctcaaaacgaaatatgtatatacaaaaccaggatttcaacaattaaatttaagacactttataactacatttgcaagcttcaataaatagagttttaattgtgtccccggaataacagatgttcgtgtttaagttctaaaaatgttcgctagactttaatatttgttgtataccaaaagatacatttgctttatttaatgtcgtgtgtgtggacttatcgcat

PCR verification status

Line verified as correct.

No slide loaded.