Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT54815 chrX 293104–295264 (2160 bp) CG32816, sc activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0052816CG32816overlapping BDGP FlyBase
FBgn0004170sc1575bp downstream BDGP FlyBase iFly
FBgn0265966CR447535845bp downstream BDGP FlyBase
FBgn0002561l(1)sc10652bp upstream BDGP FlyBase iFly
FBgn0265965CR4475212798bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ccttcatttagcattggcgattggcttacattatccaaaaagtaagagtatcaaacagagcagaacaaggcaatcaaaacagcacaactttgcaacgtcgttcagcgttaccgatttatttgaatttcaataagccccaacgtttttggagttcattatcctgttatgtcggcatttttggcctttcatctcgcgcatgcaacgaatttgaactggggcgttattgattagcgttatgaattattgataaacaaccctcaggggaaaatcgcccacaccgcaggtaaaaaaaacactatgcacataaaacaataaattgaaatacagagtatatataaaaatattcatacttagcacatttttatatattttactgttggccccatataacctaaaattatccgcccagatatgcttgggctgatatctttatttttcggagaggatgcataaatcgcaagcaaacgtgccacgttcatcatctggggagccaaaaggggagaaatatgttccaattagcgaagccaaatgtgacaggccatccacccagaagaaatcaaggcagcgactcagtttcacaggactcgcggctcggacaggcaaaagttatttgagttgtcatattaggccgtgataaatgtagttacataccaaatgtgataactctgcccctggctttggattccccggaccctggattaggtaggcgcctagtttccctttcccttgatgatgatccgcaaactgtcagaggttgttcgtctacagcctgatcattgaaaacgtatttatggtaccagggaaattccttcagcctttttgcgccagtttaaagagccgtggccctgacttttttctttgctgacctggtatcccgaagaacctaaaatttcacctgccgggtcaataggggattacctgatcgtaaaagaggtacaataagcgcgcgcgtgcctggacaattggtaaatcgagtccaattacttatcaccctacccaatttctgtacctttaagattttgcaggtttatttgaaaaaattccagaattaatataataatttttacaacatttgtttgacctgtttctttttcctgaaggcacttaaaattaaatatatctttttattgaattttaacagtttatttgctttaaataatgaaattatttacttttcttacttattattctgtaacacttctcggtttacatgccgaacaaaacctatttccgcttacagaagtaccttctatttgcgatagtccggtaataagtgtaaccaccttctgagcaattcgtcccttcaacacctctctacaagtattttattatttatgctgcgaccgccagcgtcgtcttgggcatcccaattaagtctctaagtccacgataatcccagaaatagtctggaaataatcccattagagtgtgctacataaacactaacaaatgttctaatggacggttatccctctcgcataagacaagtagttccctaaacctaatttccaacagcacttaaaaggatcagagcacaaattcaccccaagccatgacaacgctaacactccaatatttggccaactacgtggaattctcctttcgaagcccacccagaaaaaagacgatctgcacacagatcttatagtgaaattccgcaacacgtagagcgatacgtctgtgaagttttatgcattatatgaaatttgcccattaacaatcattaatttccatgatatacagaaaaaaaattatatttaaatcgaaaggtttgaggttaaaagataaactgaatgttaataagtaatacagatcattaatcagttgaatttttcttgtattaaatattatacaaaaaatcaaatgcgctttgtaaagttcattaattacgcgtagggtaaaatggtacacaacatttcttgagacttgactatcgataccagttacatagctatttggagtgtatggcatcaatatcaaaatttatttaattttttttcaataaataaatgcacgttgaatcttaacatacctttagacaaatctagtataccctttgctctacgagtaacaggtataaaaattccatttctcttaactccattcactgagctcttttatttgcataaaatgcgaagggacagaacaaaggtagagggga

PCR verification status

Line verified as correct.

No slide loaded.