Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT54827 chrX 315230–317337 (2107 bp) CG32816, l(1)sc activityactivityactivityactivityactivityactivity
active
hemocyte, plasmatocytes anlage, head mesoderm primordium VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10head mesoderm anlage3
9-10plasmatocytes anlage3
11-12hemocyte4
11-12plasmatocytes anlage4
11-12head mesoderm primordium4
13-14hemocyte4
13-14macrophage4
15-16hemocyte4
15-16macrophage4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0052816CG32816overlapping BDGP FlyBase
FBgn0002561l(1)sc10381bp downstream BDGP FlyBase iFly
FBgn0011822pcl14942bp upstream BDGP FlyBase
FBgn0004170sc23701bp downstream BDGP FlyBase iFly
FBgn0265966CR4475327971bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgcgtcctaattaccagtcagttacagttccacataatcagcaatacgggatcgacggccaactgaataatgtatgcaggtctgaaaagctggaaaatgtgcagccgcattaacggtatgctcccaagctttcatgctcaaatcgaagtccccaaatcaatcttatatgcatattgcggtaaagtagaagactgcaatcaaaaatcaattcataaacaattgcagcgtccagacgggagacgaaaaagaagccgaggcatgggctcaatcaaatttgttataaaactgtgaaagtctgcgacagcgatcggaaacaggactcaaagtcaaaggcacagatatatgcgatttgcatgcgattgaggcaacattatgcaaaagatcggatgccgcgctcattgctttgcatacaaaccccaattctgcgattctgccctgtacttttgcgattcccattatcaagtccaaccgaatgcaatttcgaactgaatcaaaggagcccagaattaatatcagtgcctggcaatcttgtgtctgcaaccccgacacaattcaatcatttcgcttcggactccctggaaacgtgggacgaccgacgaggtcgcttgatctttagcgctagattaaacgatcagcggagacagccaccgaaagacgtagtcgtcctacgagtttgacagtctacacagaaaacaattttgcttcataatgtttaatagtgatcgccacaatgtgggacgttataaaatatcattaaaaacaatatacaaatatatatatttccaaagcgtgaaggaaaaatatgcactgaaaatatctgattgaacatatcgtaatgtttttattgtcggtgtccaagtctggaaaaaacttaaaaactcagattgtacttgcatttcccgccagcagcagcagttcaccgattgtgtaggttgatctgggatggatcggtcgtggaccaagcaaattatttcacttgcgccaaccactcgaactgctggtggtctcaatgtacaacttgatttctgtttcctttgctgtactggcagtttgatttgtttaaatttaattatgcatcgattgtcgatcgccgatcgcagcgtaggtagatccgttcccggtgcccgaaaaaaacgacgagacatctaaagggaaaggacaggacaacagagcacaggtgaaattatgatggttgccaatgtcatgccgtttcttcccgatcttgatcagagttctccgatttgattatcatcgtcgacgtgctgatcgtcaaaccgccaaatgatgatcgatgccaatgtgttcttggccctttcatgcttttttaaccatttctggcacagggcgatttacattttgtactccgatttctttgggaacgtatgaagcgatcaatcaaaaatggaaacagccaaacgatcgatcgccaagggaagctgtggcaattcaaagaagatcctgtgacagaagacaaaacagtttatgaacgtttgatgtgagcaatgtgataaactgcggtttaatttcattgtatgcataccggacatatgcatgaaccccagaaccgatctcattcgagttagtcttatccgattcgggtcataacgatgtcaacgcgtgatgtacagtttgttagaatttgaattgttcggagcgcatcgtaaattgctgctgaggatcagacagttaaggatgggttggcttttaagggccaaagtaaaggcgactttttttttatgctttttagcttttatctttaataaaaaattgcatttaaaaatgttgacacatgttaaatagtagtgcgttcaaaaagctatttaaccattatattttaataaaaatttcaccgaggctgatcacctgaaattatattttttcacacaagcaaagctggtagaccgattgattgatggttgccaatcgattgggtgacacaattctcgagcattcatttatttgtcatttccgcccagttaaagtccaatgcaatgtaaactacttggttatacaaatatatgggctagatagtgagaaatgccacagagatatcttttaaaaattataagaccccatatgagtataggcattggccgcagataatcaca

PCR verification status

Line verified as correct.

No slide loaded.