Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT55790 chrX 2322950–2325468 (2518 bp) gt, CG32797 activityactivityactivityactivityactivityactivity
active
gap, posterior, anterior VDRC

Annotations

stageannotation termintensity
4-6gap4
4-6posterior4
4-6anterior4
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0001150gtoverlapping BDGP FlyBase iFly
FBgn0052797CG327973063bp downstream BDGP FlyBase
FBgn0003714tko13396bp upstream BDGP FlyBase
FBgn0040388boi15250bp upstream BDGP FlyBase
FBgn0040385CG1249618017bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gctctgatgttgctatatcttcacgctgacgatgtcgaacgcaaactgatttcctctcgtcggaaccccctgcatttataccgaaaatccggaggctgcgccgacgcctcattcacatcgaaatggcggacacgagcggccagccgaagcggtacgaagcaggtaggcggtacaaaggccaaagggcaaaggggtgattctggctttgcttctgactctgtcccgctctggcctgttgccctctctgtctcaccgctttcgaaagggttttacaagggtgcggctgccctttccctcatttggttttcgcagttttcgcaaaaatcatagttctttgtgctattgttagttcgccatttaacgtaattttaaaaagaaagtacaaagagttttcgaactttacgtttcatcagtttccgcgaaaggatatggttttttcttggttttaatattcaatgggaaaaaataggaaaattcgtaccacctctgcagtgctttacatttcgttttcatggaattggttaaaaatattcataatcaatatagagttataaacttcggctctattttcataggcgttcattgcgatgttataagtccaagtttgaggaaaccccagatttttgtatataccagcattgtgcatttgattttttattacaattgtacctaacttacttgctttgacatccaactgataaaacccttacccaaaaaccaatcttaaaaatcttaagttattaaacctttagatttaagtaactgctgtatatattgctttcaaatataaagaataaaccgcaattaaacatcgtaggctattctcttcagcactgaaataaaccatacttctgaatcttctagaacatttcgcatatcaaagaccccccgaccgtagactattataattacactcaaatcatacttttctggccagaaagagaggcatctggcagaagaaaagagatggaatctagtttgttgataatagatgcacaacatccaagggttgtgatggctaaatccgtttgttttgcgcttttgtttcgaaatccttttgctgaccagcccatctagaatctgtgtatccatgcgatggcgaattcgttggattgtgcgtgacaaattatggaaattaggacgagttctggcgttcttgcaattttcagcccttttcggctggcgtaattcgcatccttttcttatttcggcaatgaaaactcggcttcccggaattttggcaaggacactcgccagtctgcccatttgattcatgacgccgccagcccgaggatcgagaatcgagagtccaggatcattgcgacaagtggccgtccgtgttgactgctcgtgtttgccctcctccttaaacatccttgattctacgtcctttatccctttggcttccgctgcggcgtgggatgtgggatcctcgacaagttgtttcactttgttaactgtttgtcctaacggtcgcctcgacagccaacggaagtgggtagcggtacaaagttggctatcatccatgggaaatgttatgctagatacttactgcagctaattcgaggacataacgtagtttagatttgttacgctgaaatgttatcaaatcctatcaacaatacctacattatatactatctttcattcattctctttttacaactgcccattcagggggattgggtgaattgcaaataaaaagagggatcgatcgatggtaatcagtaaaaaaccgcgaacttatccgctaatccgtgcgctaatccaaccgtaaaaatggtggattaaactaaaactcggaccgtcacgtcgccgtcattgagtcgatcccttacctgcggttaccgggcccgaacccgagcccttccagatcctggacatacgtatagcccagcccaatcgatcccgagcagatgccataaaaagtcgcggccgaagtcgaagccaaagagttgccaagttcggtgtaaaaaccagattcagcgaaaaaaaaacgtaaaaaacagcaggccataaaaccatatattcatatactcggactgctgttccttcgccataatgagctccgaaccaaagatgcaatatttgtgcaatcctttgagttgtgaccttgggcgcgttttttacggaatcatctacctgatggccgaacgggttgcccacccacggtatgcgctgtattaggctgttatgctgttgcctaaaaaacatccaaagttttattgcataatggacgcttcgtgcgaaaaggcctcattccgagtccgcgggccctaaaaccgctgcagttttttaaggagccataaactgatatttcggacaccggcggtccttaaaaaaaaaagggttctctcctccgaccattgtggctgcgatttttatattggtccgctgctaggtgacaaagaaaatcagcgactaattgactgaaaggggttttgccttatatgacccgtcccacccgtccaaaaaagggtgaggagtggtttggatttggattcgtgcttggtttcggg

PCR verification status

Line verified as correct.

No slide loaded.