Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT55791 chrX 2324883–2326982 (2099 bp) gt, CG32797 activityactivityactivityactivityactivityactivity
active
gap, posterior, brain anlage VDRC

Annotations

stageannotation termintensity
4-6anterior endoderm AISN2
4-6gap4
4-6posterior4
7-8brain anlage3
9-10head epidermis dorsal anlage3
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0001150gt1884bp downstream BDGP FlyBase iFly
FBgn0052797CG327974996bp downstream BDGP FlyBase
FBgn0003714tko11463bp upstream BDGP FlyBase
FBgn0040388boi13317bp upstream BDGP FlyBase
FBgn0004050z16919bp upstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

ggccgaagtcgaagccaaagagttgccaagttcggtgtaaaaaccagattcagcgaaaaaaaaacgtaaaaaacagcaggccataaaaccatatattcatatactcggactgctgttccttcgccataatgagctccgaaccaaagatgcaatatttgtgcaatcctttgagttgtgaccttgggcgcgttttttacggaatcatctacctgatggccgaacgggttgcccacccacggtatgcgctgtattaggctgttatgctgttgcctaaaaaacatccaaagttttattgcataatggacgcttcgtgcgaaaaggcctcattccgagtccgcgggccctaaaaccgctgcagttttttaaggagccataaactgatatttcggacaccggcggtccttaaaaaaaaaagggttctctcctccgaccattgtggctgcgatttttatattggtccgctgctaggtgacaaagaaaatcagcgactaattgactgaaaggggttttgccttatatgacccgtcccacccgtccaaaaaagggtgaggagtggtttggatttggattcgtgcttggtttcggggaattgccgttaactcctttcgcggccctttgtcttaatgggttaacagtcgcatattggaatccttagcttcgaatggcccctgtcgtaaacgtaagttgaaagcaacttatcacatattaggactgccattttgtttctgagaatctgtattcccgctttttacccctaaaaaacccctagtttgggataagcaaagatcagcgctctcctccgcactttcatctcgaagtgatggtaagtttctggtaataaattatctttttcatatcatcaattcttgcaagataatgccaacttcctcccaaaggaactccttgaaaggccgttcttcagcacaattgatgaaatgagattactttcaaatgtatgattagtttggccgtcattcagttgattctcggccacgatggccgtctaagcccatcaggaaaggcacctatatcctgcgatgctaatgaggaagtaagtagtcggccggcgaggaagtgaacggggattacacgtgctcctcggccggacaaaggcactctcctctcgcagcagagtgtttgggctaagcgaaaaagactaaccaggatcgagagtcggaaatcgagaatcgaggacttgggatcacttgtttgttttccttggcatatgcaaagtgcacacttgcagaggataatgggaacaggtattgctcggctcgatgtgtctggggatttgccttagccacttccgcaaacggaagtgcacagctcggcaaaaagaaccccgactaaaaaaagacacaagttaagtactcgaagggaacccacaatggccatagcttccgtcgtcaaatcctttggctaattgttatcctatggctcctaatcccacgtccagcaaaaggctgctcaattatggcatctctttaattgagagacgtcgagccgcttcgaatagagccttacttcattcaccgctgaccagccaagcgaaaagatctcgagcagatctcaagtccggaatatgaaatccggatcccaaattcaaaagcagtattgcattactatgccaattagtgcggttttgattacccaaatgacattggccttgcagacccgcaattctttggagtcctcttatctgccgagcaagttgcatcttccaaattggggcgacatcgcgtctatcgtattactatcttaagtttgcaccggccaaacatcccagcaactcaatgaactttgaatgatcgagtgcgtggagctgcgaatgccaaatattgaaattgtgcgcgataagttcaaggttctgactcaagattgggtcgatcgattgatcgatggggggaccccacacggaaaaagtgtcatttaatgctcgtcaaatcgacgcacaaagagctcggtgtccagagtgcaatttaaatgggcaaaactaacttgctacttccttacgccatcattgtgcctgttgtcccgttgtcccgttgtcaggaccccaggaagatggccaggatacaggggatagaggggtgtgtccgt

PCR verification status

Line verified as correct.

No slide loaded.