Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT55847 chrX 2432168–2434263 (2095 bp) trol, mir-4955 activityactivityactivityactivityactivityactivity
active
leading edge cell, dorsal epidermis subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14leading edge cell3
13-14dorsal epidermis subset3
15-16leading edge cell3
15-16dorsal epidermis subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0261451troloverlapping BDGP FlyBase iFly
FBgn0263531mir-49556605bp upstream BDGP FlyBase
FBgn0260753Pdfr14071bp upstream BDGP FlyBase
FBgn0040377Vha36-340956bp upstream BDGP FlyBase
FBgn0040376CG1375942897bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tacgatttgtgtcgcctgggaaatggtaactacaatatatcagctgatcaccaagctagacattcaacacgcttcacagaagctaacgaacttgcgttatgaaaacgctgacctggccaaaaagaacttttgagcatggaacgcctttttgctggccatggaaaactgaaaattcgatcggatcggatcgcatcggtttggatcgtagaaaaaaaaaacgcatatgaacagacgaaacagtataacttcgaatatttgtggtcttagtcagagacataatgcctcgatattggagccgaaaaaaaggtcttgctaatggctaatgaatgataaggcaactagttctggccacaaataaaataatcataaactgtggcagcttctgcgggcagagcgagcaagatatagcgagttgagaaaccagaaccagtttgcttatagagtgacgatctcacacgaatttggtcatgcaaatgtcagccgcatatgcattaaattaagattcatcagcgcacgagtgtcgccagtttgacagccactacaccatacagtacatatgtatgtacatatacatatagtgacacgcatacatatgcacgtccgattcgatcccttaacctggtcccactatcagtcagttgacaccttatcaacttgccaagaactgggaactgagcatcggaaactatgccacctatgtacataccgtacatacatatgtatgtacgtatgcagccgctatatcttatctggccggtatggggtttcttccagatactcgaggcttacacagccgactttgtgtgggtaacattttctttaattgactgctccgtttgccccttttggcggcaattagctgaaaaccccgcgcttttgttctccaatggagtatcaaatagagaagctgacacaccgaaatatatatatatatatatatataaatattttatgtcgcccagtagttggcaccacgaagtgcgaacacgctttactcgatctcattcggcaattaaattcatcattgaaatcgatattcattcatctgcaatctttcaaagtattagttgtgctaaagattggtagtaaattgctaaaattttacatatgtaaatatttcatcgatctcttttagtctgatgctttaatctataattttgcttaattaccgtaatgtacattatttaattgctatctgcgaatgattaatcaatgctctggcatagcattttatttatttatgtcaaatttgttattaattaagtagcttatcgctgatattttgctgttattttgtttgtttgatagtcgtctatggctgaagcgatcagaaacgtatccaaaagcgactgagattcaaatgaatcccgaaatcgaaccgaatcgagttgaaaatcaaagtgtttgctggcttattaaagcataaatatatgcaagtcgcgtaaggcaatggcaaattaacgaatttgcataattatgcatcgttttttttgttttttggcttgtttgattgctgctcttatgctttgtttactaattaattggcgcggacttcagcgcagtttggcagccactggggggggggcgattcggaattgattgttaaatttatttcgccatttgggcccgagcagcaattaatacaaattgaaatgtgaatttccattgaaatgggagcctccttttttatttatcttcgttttcccttgacttcgtcatgctccgaatcatgacgatgaggatgatgcaactccattggcatcaaaattgggcagacgccacatggatacgcgtatatacatatgcatattgtatatggatatatctctcgatcgctgtgaggcattttttaatttcccccgaaataaaaaagcgtttaagattcatggaagcgattgccgccgaacagaagctgatgtcacccgcattgtcgatattttcatattttcatgtttcaattcattttcatttttcatgtttcatttttccaatttccggcgcactgattatgattaacgattaggatggacgcaaagatcgatctgtaattggcagtcaattccgccaattgaaaaatcgcccctaacattttcggc

PCR verification status

Line was not verified.

No slide loaded.