Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT59438 chrX 9630797–9632904 (2107 bp) Sp1, CR43498 activityactivityactivityactivityactivityactivity
active
anterior endoderm AISN, procephalic ectoderm anlage, anterior endoderm anlage VDRC

Annotations

stageannotation termintensity
4-6anterior endoderm AISN3
7-8procephalic ectoderm anlage3
7-8anterior endoderm anlage3
9-10brain anlage subset3
9-10ventral nerve cord anlage subset1
11-12brain primordium subset2
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0020378Sp1overlapping BDGP FlyBase
FBgn0263509CR434988277bp downstream BDGP FlyBase
FBgn0000233btd39207bp downstream BDGP FlyBase iFly
FBgn0030151CG135441978bp upstream BDGP FlyBase
FBgn0264786CR4401644348bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ggacctttttgacttattcaccttacacatccagctgagtatcacttagtctaattcccctacgactatgcattctgcataacaaagatttttgctaatttctcaacaaaaacgggggaaaaaaaggcaggagaaaagaacgaggacaatgaaaggagaccaaagcggagataattccgacacacacggaattatggtgaaagaaaggcgcagagcgctcagatttgtcaggagattttcggctcaggggcaacttaacaaggcacaacaatgtgtggccaacgacgacgatgatgatggtgatgatgatgacgatgatgtatgccacatatatcctatatatgtacgagtatctggtatgcagtttgttttcgttacggctatttagtgctttggcctgctcaagcgcctcggtttttggtttatttgcttaggcggcttaggactgaaatgccatagaggatttatcctacccattcctcataacgaaaaataaaagaagacaaaaatcctctgtgtttgctgtgcatttcacaactttttatgtggtcatatttcttgcaagtgctgaagtgtgcctgactgacatcccaagttcggatgtttgggatattttcttgtcttgtcttgtttttttttggttgggatatgttggggggcccttcgaatgacaggaaacgagcgccgagccgtaaaacgcttcaactccttggcatgtttaattgccgttagtttttacactcgccaagcgaatatgtcatcgaatgtcaaaggcagcccactaaaactcagctcatttttccgctttcgcctgatttatgttgtaggtggtgatttacgaggagggtaagtgtttgggttagcaactcagactcagactttcaattgaattcaaccagatcctttaggatttattctcgcttgtccgtaactgtccgttatgcagagtttgtgtccttaagtcaattatcagctgacattacgataatatttcaacacctaaataacttcatttaatccctgaagaatgctgttaaattgggtatatcatatgaaagtcaaaagtgtttgcgccccctgatctttcctttgatagctcccactctttggtgtctttctgtcagcacttcccaaatggaaaatctcagccgcacagaggcccagctgtaaatattgtgttaaacattaaatgaagtcgttaaaatcgtttaatgatgcactcgttagtcagtcgcgttgacaagtgaggtggcctttttcactagggggaactcggatgagacgactcctcccactttttggctgcttggcaatctggcgcatcaaaatcacgggccatgacatcagtcggctgttgtcaaaaggaattgaaaggatgtttgatggcatgctaaattgacaaatgcatgcaaaacacttttcggctgccgcatttgcgcataccgtctcattattcatagctagtaaaagtcgcatgttgccgccgtgcggagatgttgctgccacttctgttgctgctgttggtgttgcgtgtaagttgccatgcaattggcaaatgcttcattccgattttataccactgttctccactgcggcaattagcaatcaaggggtgtgagggaaaagcctttccaagttcttttcttttctttgtatttttcaatatttaccttgcccgtattgtgtgcacctatgcaagttacaacaagtgttgctcttgctgttgctgcagctgctcaaagtcaaactgttttgggggtcttctagtcataaggtcaaactgcgcgcattatcaacgctgaagccgcaagaaaatctgcaataatttcgacactcgaaaaattaccaaatgattttgttaagttgcaagtgatttttaattataatgctattcaaatttgtatgcaagccaccgataaacttatttaaactatttgaaatttatgaaataacttgatgattctgaaacatattcgaggcacatatttttgtctgagtgtagcgcagcaacattatgcttaagcgctgcaagcgcttcgtgcttaaaagcgcgcgacacacacacacatattccggggaaacaatgttgctgttgttaggcccgccag

PCR verification status

Line verified as correct.

No slide loaded.