Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT59793 chrX 10345112–10347193 (2081 bp) CG32683, snoRNA:Me28S-A1705 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0052683CG32683overlapping BDGP FlyBase
FBgn0086046snoRNA:Me28S-A17057091bp downstream BDGP FlyBase
FBgn0030204Or9a7107bp upstream BDGP FlyBase
FBgn0083167Neb-cGP9657bp upstream BDGP FlyBase
FBgn0261710nocte10786bp upstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

aacttttgattaggccacgaggtgtactttagaaataaattttcttttaatccgatcataaattacattgcgatatggagtgcacaatcagcgggcaatagagccaatagagataagatctcctaatttcattcatgaactataatttacatataagcgcaaaaatcgaatattatattaatatttcgaagacgtggcacactaaatattacattccaataaacaactttttaattatgaaagaagtttcttcgggcaagttgacatccagaaaaaaaaaatgacaaaaaagggtgcgcttgtcatccaaaaagttcccaaaggactcgctttaaggtctattttcggggagtggctggtatctatttataaagcttccccaattggaatcccccaccaaactgcaaaatgtgttaattcgttgtacatagcagtcaacaaaggtttttacccagaaaattagggtatgagattaggttaaggattgcgatctaaagagtgggtcaacttgggctaattgacaccgaagtcatttggagtggtgtaattatattatgactctgtgtttttaaaacacttggagttaattgtatattaagcgtttgtttcaagctggagatttcaaagattttacaaggattatatacataatatgtataataaatactatattatagggttatacttaataggtatttgttaaacatacattagaagacctataactttacatatttataatgtcttacttgttgtattggatgaactaatttccgtataatatatatatatatatatacatatcggttaatataattaaattatgtatgtatgtatgggcatgctattcgatatattgtaatggtgttgatttaatttgggacagttggcttcacttttcgggccagactaggcccaacttttggcccgacttgcctccacaacatcgcatgcccaattagctaatggatattgacaaggtcgctcggagcgcgaggatgggctggatgtcgatggagtgttcggaacgggaatggctatcggaatgggaatctgtatcggaattcgcttcactcacctgtcgccgtgcgagtccctgtccctgtcgcgttccagccccggatttggattggccggagcgggtgcatccgattcgccagcagctgcagcgccaattgctgatcccgatgcctcctccacctcgacatccatctccacttccggttccgcttccggatccggtccagatccgcaacaggcatgtctgctgccaggagcctcatgctcccgctcctgctcctgctgctgctcctcctcggggattggctccttttcctgctgcttgtccgacatcctggctctttccgtttcgggtttttttcttttttctaggtcctgctaatatggacgggtcctttccaggtcgcgatgaaatggtacagagcagatgcccaagtgttgtaattgttttttaataaaatcgctgctgccgctgcggctgcccaggcatgaagtaaaaaaataaaatggaaaagaagaaatgaaacgaaacaaaacaatgccatgcgaacaaaggaaaattaatgtaaattaattgctgtggctggtggaaagcctcttacacccagccctcacttttcttactttcttcctcatttcctggtgtttttttttcatttacattttctttttgtctgttgttggtttgatggtcggaccaaattagccgcaatgttaaaataaaaagcaaaaagttctccttactggattttaaattgtggcgaaggtaggagagaaactataatattatttcaacgcttcgggcgagtaaattagaaactgcgttggactgaagaagacccattaaaataacgttcatatttatataaaattaactcccttaccaataatgagtggcaaagcgcaaatagagcaagttgagttaatttttggatgatttattttagctgggaagctacttaaatgctttaaaaatctatatttattatcccactaatctgttaatttgcagagcagaaatatctccctgtttttgagccgcaatggaaaagcagcaaaaag

PCR verification status

Line verified as correct.

No slide loaded.