Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT63185 chrX 17219754–17221925 (2171 bp) B-H2, CG5445 activityactivityactivityactivityactivityactivity
active
ventral nerve cord subset, ventral nerve cord primordium subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12ventral nerve cord primordium subset1
13-14ventral nerve cord subset3
15-16ventral nerve cord subset2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0004854B-H21547bp downstream BDGP FlyBase iFly
FBgn0030838CG544520247bp downstream BDGP FlyBase
FBgn0024238Fim23793bp downstream BDGP FlyBase
FBgn0030837CG866141222bp downstream BDGP FlyBase
FBgn0030836CG866443011bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgggtttatttgggttaagttatggcattttaaaagattaaaaatgaggccttatgtgctaataatataactaatattatattcggtggtgaattattagattagaatacactagaagattgtaaatgtaccatattaagttccgctcaaaatgaatgtttatgtgcatcttgggtatgcaaaaatgacgtttttatggttctcagattttcgccccatttcctcacaacaatgtagttgtggaaatcagaataacatcaatttaaatggttatccaattcgttggatatttatttatatttagggttaatgtagtctatacaatattaggaagatatcggaatatcatgaatttaaatgggcctgtttgattttatcactcgtttccacgattgcctccattgtgcaatgccatttgtcgcattcaggcgagtttggcaaatttgtgtcttttgtgcattcgagctaacaaagtgctttcacaccggaagcaattgcaatgcgtttgccgtcgtccttgccaccgcaccaccgcaccactgatccacccagccaccccattcttctccagttaattgacaactttctggccagggtgcgccttaagttcgcccgctttttatcccatgccatcctccaacgacttctttgtgaggctaatttgtcacaggatgccaggatgatgtcaggatgtgaggatgccaggatgttggcattcaggatggagcaggcgatgctgcttcattacacaggcgatttgtcgtgcacaaagcgaacaccaaatcgatgagaaaatggtacgtaatgcccacagtcagctaaaccatatactattataattaaatcaattaaattaataaataaatcaaatattttattccttattatcattattgtgataaaatattatttcaatatttttaatcttgtaatataatagaaaagtaaatgaaaagagtttatttgttcctttaagcacacgctgtctttgaatatcattaacataatttaaaacgtataatattatttgtgtaccatcttattttacattttatatagttttaggctctgtattcctgttaagatataagtataccaaatatttctctgcatgtacccacatggagtcacccggggggttgaagggaatgagattttgggagcttccgttatcaataaatttgtgcgcttaaatgcgtgtgtttatcgaattagatggcggaggtcaggaagtcaacggagatttatgttcggtcaaaggggcaagtcaggcgatgcaaggttatgtcaatgccgagatacgagagtatatattcctccagcggatcccgatgcctttaaattactgtgaatgggctatgtggcgccagggatcagaaaaatcgatttgtcggtcgtcgccgccagttaaacgctgccaatttgccgcactgccctctggagctgctctaaagttcctttggatggatggggcatctggaatctggacctcaaatacgaacatggacccactggcggctactggttttgaacctgccactgaaaaaccgatgccaactgaagccgccggcccaatttgcatgcgttcgatttgcaattcgctctgcaattgcatttgcggttttcggttttcggtttttcaatcaattctaactgtgcaaactgcaaaaggcaatcatcagtctgtgcatgaaatttacgaagcctagatccaggatcatccgaaccaggcgggtatcctggaaaatcatttgcctaaagataatatagagtatgcatttataacacggtttacctacccactaaatgaacaacttccatgttcgagctcaaggcgagcttgtataagtcatgaacttcctagtttatccatttaaatcaggtctcttgcgtttggattaacatctctgcaatccccagcttaacatacccctccgtagggtatccaaaatcaaaacttgattccctcgccttcgtggggcacacgccaatgtcaaaaggttctcacagccgagcggcggcgacgatgatgatgatgcgatgatgatggctgaaaaggcgatcccatacgtggcgatgtgatatggcagtaagccgatactttcccggagctttgatattatgtactgtgcacttttttgtggccaagtgccgttagccgagcttgtgtgt

PCR verification status

Line verified as correct.

No slide loaded.