Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT63702 chrX 18178471–18180670 (2199 bp) upd3, os activityactivityactivityactivityactivityactivity
active
lateral epidermis subset, anterior spiracle, head epidermis lateral subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10lateral epidermis anlage subset3
9-10tracheal system anlage3
11-12lateral epidermis primordium subset3
11-12tracheal system primordium broad3
13-14lateral epidermis subset4
13-14tracheal system subset3
13-14anterior spiracle4
15-16lateral epidermis subset3
15-16head epidermis lateral subset4
15-16tracheal system subset3
15-16anterior spiracle4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0053542upd3overlapping BDGP FlyBase
FBgn0004956os20916bp upstream BDGP FlyBase iFly
FBgn0030905CG1505924922bp downstream BDGP FlyBase
FBgn0030912CG602329686bp upstream BDGP FlyBase
FBgn0030913CG612338520bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gccacaagctatatatctcccccgactatatttacacactgatatatgtatgtacgatttacacctctatgtaacttagctttgattaggaattaacattttagacatcaaatacaaacacaaatatacaaatatacaaatacaaaccattgaaagtacaaatgcatcgagagtttatctgcggattgggtggtcctctcctggcgccatatcaattacactcatgtgtgggggtatagtatatacgagatatattcccaccgaaattgcgcatacgcaccgtgctggatgagatgtaagagagacataaaagtgtccaaacaattcccctttacgatcgtcgccgtggctttaattgcagcagaattacgcggcatttatagacttgttcaaatattttatgagccatataataattctctcccctgggttttgggtttgggtttttggcttgggtcgggatcgggatcgggatcggaatcggaatcgaggtcgtagtcgtagtcggagttggagtcggggtcacctttgtccctttttgtcagctgcacacaaaacaccagcgatttaacgacaagaaatgtttgtcgccgctcttgattcaccattctccattctccattccccgttcccgaatctcccttctcggctcttcctttcacagatctccaattctcccggccttatcgctgggccggaatctacgcgcgcaccttcactgagccctggatttttgatgttctccactgcggtttgccggagtacccgaatcgggtttatcgcacacaatcagcaattgtcattaatttcggactcggtgtacgtgctccgatttgtctgcccagcacagctcctccatctccaactgcatcagctactcctactccgactccttctcggtgactgattcaacaatttaatatgccaaagatagagcgacagagagggatgcattcccattctccatcgccatctccatctctgtctgcgtctccagtaaagatggttatcggtctgattttattgtgtgctctccctgcggcagcctctccgtcgtccgctgatctggcgaagatctgtggccagtgatcttggccaggtccgagatccatccgaatgaggcgcacatgcaactatgcgatcccattcatggccatccgccgatagctccctctccctctggctgctttgcatgcaggctgcgtcaacccttttgtccctttcaggtgcacgtagcgcacatctatcttcagttttgataggtttttattggcctgacctttattaaattgaaaattatgtctttctatgagaaatgttgaaatgccttcacccctctcactcgatctgtctctctctctttttcgctccctctctttccctctccggaaaccccttgtttttcggggcatatgcattatggtgcgtattgtgggaacaaaggtatcaagggttgagtacttatagaaattagtggcttgttttatggtattttggtgcttttaatgaccgaaccaccgagaaaactattaatgatgtccttataaaggataaccatcaagaattccaaatgcgaatataacttcgtagatactttatacaaaacaactgtataatctcagaaatattttatatttaaattcaacgcgattctactttttacatcccaaacttgctatgttgtcttaagaactaacatctcttcctttaatgggtatccgtgctgtcgagagccaggctcccttgtttttgggacctctcctctcctggctcctgctgaatgaacttttgcgcctgcacagatctaatctaaatgttcactttgttttgtttctgttttctgttcagttttaaatctctggatattttgtgtccaacttggcccgtcacaagtcacgtgcagggaactgtttttgtttcagattttttgtgatcttggtcgacagtgcgacggcaattaatttaaaatatcttatttcatttgtgtgtttttcttgcttttccccctcttattttatatttaacttgtattcgccgtgtgtatttttgagttatgttttccgctgcagatttcctccgataatggcgttacatttatgttccctaagtgttcccaagcctccagtggttcggtggctcagcggcgaagggggcgtggcgcgaagaccgcccaccagggcgtgtgtccagtgtccagtaa

PCR verification status

Line verified as correct.

No slide loaded.