Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT63703 chrX 18180222–18182402 (2180 bp) upd3, os activityactivityactivityactivityactivityactivity
active
dorsal ectoderm anlage VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10dorsal ectoderm anlage4
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0053542upd31594bp downstream BDGP FlyBase
FBgn0004956os19165bp upstream BDGP FlyBase iFly
FBgn0030905CG1505926673bp downstream BDGP FlyBase
FBgn0030912CG602327935bp upstream BDGP FlyBase
FBgn0030913CG612336769bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gggacctctcctctcctggctcctgctgaatgaacttttgcgcctgcacagatctaatctaaatgttcactttgttttgtttctgttttctgttcagttttaaatctctggatattttgtgtccaacttggcccgtcacaagtcacgtgcagggaactgtttttgtttcagattttttgtgatcttggtcgacagtgcgacggcaattaatttaaaatatcttatttcatttgtgtgtttttcttgcttttccccctcttattttatatttaacttgtattcgccgtgtgtatttttgagttatgttttccgctgcagatttcctccgataatggcgttacatttatgttccctaagtgttcccaagcctccagtggttcggtggctcagcggcgaagggggcgtggcgcgaagaccgcccaccagggcgtgtgtccagtgtccagtaactccaatagttccgattgtaaaacgattcgcgtggagtttctgattcgcgactctcccacgaacctaaatcgctggctcagcgattgccgtccgcctgtgggaatctcccgcgccatacggaagattctccaggagtgcggggaactcgaggagctggcggagctggcggagatgtcggagtctggccatctcactgaggtgttgaaatccccacagccacaactcttgcccaagtcgctgctcagcagtttctccgttcacggaatcgaatcgaaagcaatgctccgaccgctggccagctgctcatctgttcatcttttcatttgctcttgggcaatcaaataaaatataataaaatttccattagatgcgatcttattgtaagcataattgtcgagctgcaaaattcgaggttgagctcgatttgctgacgacactgaaaacagtcaacttggccagagtgctggatgggaaaaagtgcgacacttcccagaagtgtcatcattgtggcaaaggaaggtcttctcccagctaaggtgtgccaaggagacttttcacttgtgtgtgaataaaatataaaagaaaatataatacaggtacttctaattgaattgcaaaagttatgtagctcagcttcgaaatattcaaggtttaagtgactttttgtgccgttcccatagcgattgcctcatatttgagtgactgaccgacatggccagctgtaattccattaactttctccatttgttggccctcaaatcgggccattcaataaccatctgaccaggacatacgtatacccatcctcatgccgtctaagcggcgccttggcccaaataaattacgatcacttaacaatgaggcggcattttcatggctttttttttggcgttttcatgcaacctcccgaattttccgcttaataaggtcgaaaggtgttttcaattgcgaaatgggattcgtattcaattgtctgcactcgagcgtctgcacataaagtgacacaaattatgaaagaaccatcgagggatcgatccactcacatcaaaggcgacgcgacgcgcccactctgcaacggccaacaaatgacaattgaatcgcctgccagcgggacaaaggcggtactcacacgaagcgggggttggggggtgtgcgaagcggtatgaagcggtgcgagtgaggacgaggggcagctggacagtcgcacaatgaagtgatcagtggcggacaatgggcgagcgtttttaattgtcaatgaatgccacatcagctcttgaccttttgcggctatttgggaaacagttgctcactccgtgcgaaaaaggtggcggtggcttcccacccaggtgagatcagatgcaataagatgagatgtcctgaaaacgaattccaatgcgacgctctggcgattcagatgccgattttgatggccattgctacaatggaattgatataattaatggccagtttggcgccagactttcggtacacaaaaagggaatgcgaaggactgcgggaaatcatgtacactcaggaaatatgcgtttaagtactggatttaaaaatatctatatatctatatctgtagtggaaaatttctaaactcaataatataatagtaacaatatgtttctgaaattacttactagtaaaagatcaaataatagtgaattaataattgctatacaatgtacactggcttagtacacttttgaatagcaattgtaacca

PCR verification status

Line verified as correct.

No slide loaded.