Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT8279 chr2L 16195279–16197459 (2180 bp) CR44734, CR44735 activityactivityactivityactivityactivityactivity
active
amnioserosa VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12amnioserosa3
13-14amnioserosa4
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0265947CR44734overlapping BDGP FlyBase
FBgn0265948CR44735566bp upstream BDGP FlyBase
FBgn0001991Ca-alpha1D4740bp downstream BDGP FlyBase
FBgn0265949CR447367831bp upstream BDGP FlyBase
FBgn0264350CR4380616092bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgggtcttccaacttctttcattcgcttgcaaattcatttttcgtcggcacgtgagttgatttaaaagctgcaaggaaagagatttttggcagtcaacttaaatttatttgactgcttgattcatacgaaatcaaaggtaaaggtaaattcaattttttccgagctgaatttttgatagccaagtgatgtaatttctctgactgaaggtaataaagttgaagcaacattctgttcggcgtggaattcaaaaattattcttcaccagatcagggtgtatatgatatttcgatattttatgaaatgatttaatacattttgaattattaaggacatttgccacattatctctctctttaattcacttaacttaaaaccggttttgggtcattccatctatcattcacagaagccaaaatgtaacttttccaaccagcttcaataatgtagccatactctctgatttaaattcgtgcgattctaattggtgtaaagcaattttatggctgttgaccggaatgtgcgaaattttcaactaattttgatgttttgccacacaaactgcagtaaggcaacccacatatttcgcctcccagcagtgaaagacgtgtggagtcgaactctcttcaaatttgtgatgtccaaaggacataggacattccatcagagtgccaatggcgaagtactaattacaaacatgtcgccggttcattcagttcggatttgggttttggccaccatcctagttgtccatttccatgctcgggccatcatcatctcattttccccgaaactaaatttgtatgttggggtttttgggcactttgatttgtgatttgatttgcactcaaccagccgagagttctatgactgcagtagcattcgggtaattatgatgtacggctgcagagaacatgtaaagttcgaccaacttcgcctgatggccattgacccggctttatctaagcactcagacacaaacaatgataatggctgccctttgttcgcattcgaccaagacgccaacaattgtttggaatttatgaagagcttcctgagtccggaatactgacctgacagatgttcaagtaagtacaattgttgccacttaggatgcacttacaactgttttaacttgaagtctcacatatcataaaatttgggttcaaagttcatccacttcctggatgaaaaagcacttaatgcaaatgccagttcaaatgctaaaattatgaagctagctctaatttcgtcacgattcaagataacgttgatttttacctacttggcataatcatgacaacttgattttagtttcatttgggattaagcataaaatgctagattatagtaaattagtaatgacttccaagacaacacacagcacttattgcccaattccttttgtcgttgcctaattatttataaatatttatttagtgtgcaaattaccagactgtactggcaatattgtcgtcaattaagtcaggtaccaaagcataaatatttactcaatgcgaaggcaatgataatatgctcaatttgagatgtatcccttgcattttggcaatatttgtggggcaatgaaaagcacgcacacttacatgagctacccaaactttcctttgggcctgagtttcctaattatttgccattttggctacacgctcttgggtttattgatcatactcggtcagattttggtatgactaggaattgagaaaatgcctgtttgaacattttactcatttatggtcacaacaatatgatgacaaaagtttctgggcctgggtttatgattccgtttggttagtttgcagttctgttttgttttccttccattttgcatatattttatgatgcaagtacgttgggcagagaggggagtgcaagttttgggcaggccatattaaattagtttagaaattgttgccctataaacaagtagatttgcatatctcttccgcttttctctggccatacatatgtctggagtatagagaatacaaacaatatgttttcactcagtggcgttcacttattaagatatatacattgtatttttattttattcaagtacagttgtcttaatttaagtgaacatataattgtatttgatgggagaaataattatcatttagttatgcagacgttgagttaaataacgattcccacaccccgtt

PCR verification status

Line verified as correct.

No slide loaded.