Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0009 chr2L 21327–21958 (631 bp) l(2)gl, Ir21a activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0002121l(2)gloverlapping BDGP FlyBase iFly
FBgn0031209Ir21a496bp upstream BDGP FlyBase
FBgn0263584CR43609625bp upstream BDGP FlyBase
FBgn0051973Cda54075bp upstream BDGP FlyBase
FBgn0031208CG1102311844bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgcgcgtcattttaacacacacaaagtcgcgatcggtgggtctagtgtgcccgtgtatctctatcgaaaaaatcatatattttttagaaggtatatttaccatgactgactggaatgggtggagaacatcgctttgggagtgaaactccgctataaattgccatttgtttttatagcaacctttttgatatggtcgccaacttttatataattataataatttttgtatatataatcataataatatcatataataatcaccgctgtcgcacgaaaaatttagaaaatgtgccaacgagcggaatttttcggaacgatcgatgttttaccataacctgctatataaattgtgaaccactttcttaacacaaaactagatgtgcttcatttataacgcaatgttgtgatttgtgggcagtgtgaccatgtccaatccgctttcaagtaaaaccatatattgccacaaactttcccatacaaaataccaaacaactgtaaaatttgttgttgcatcaaactttttatttcaatacatataatttcatgtgcactaaagtgattattttgtatttgcatttaaaaatttctgtgattaattgtcaatacggaatgtatgtgaggaaggattgccg

PCR verification status

Line verified as correct.

No slide loaded.