Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0015 chr2L 33156–33884 (728 bp) Cda5, Ir21a activityactivityactivityactivityactivityactivity
weak
midgut chamber VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16midgut chamber1

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0051973Cda5overlapping BDGP FlyBase
FBgn0031209Ir21a8002bp downstream BDGP FlyBase
FBgn0263584CR436098920bp downstream BDGP FlyBase
FBgn0002121l(2)gl11781bp downstream BDGP FlyBase iFly
FBgn0031208CG1102323673bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

aggaaaaggtgtggagctggtcgtggtcatgtaagatgtactggaagcttttgtggttgtttttgacttgtcaggaatatgttgtttatatggcttatttgcatgcgctttcgagctgttgaagagacgtgtattggaataagtaatcacataagtgttagtaacttatttaaatacgtatagagtcgcctatttgcctagccttttggttctcagattttttaattaattttggtttttggttatcgttttcggttgggctgtaatctgagacaactgcatttaacggatagaagcatgctcatgcgtacctatatttcgaatcacctaaacgttatcttatgaatagtcatgcaatatatgtgagtaaataatcatattagaaagataaacaaaaacaaaattaagtaacaaaagtgtctaaacagtcagcatagcttttgatccctgtcacgacgcaaaaaagtgtgtaactttgctgacgctgtatatatcattacattgctataagggtgtaactgtgtgatagccaaaattttaagctgcaaatggtttgtaaatatgatatattacaagcttcatgaaaatcggtttatgactgatccgcgattacgttgaaaggcgactggcagagatacttttgttcagatgttttttcaggtagcgattccaatgaataggtaaaataccttgcaagttttgttgttgtcgttggaggaaatgtggatg

PCR verification status

Line verified as correct.

No slide loaded.