Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0629 chr2L 1287003–1289097 (2094 bp) robo3, a5 activityactivityactivityactivityactivityactivity
weak
anterior ventral nerve cord subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16anterior ventral nerve cord subset1

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0041097robo3overlapping BDGP FlyBase
FBgn0011294a542158bp upstream BDGP FlyBase
FBgn0031327CG539743986bp downstream BDGP FlyBase
FBgn0031331CG544047125bp upstream BDGP FlyBase
FBgn0053923CG3392354362bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgtaggcaagccctcgaactcgcgacgcatgagaactttggaagatggtaaggatctagtgtgccatcctctgctcgttattgaatctatttctttcggatttattatgatttattgcttatctgctggcattaacttggcttcaacttctttcgcagttccggaggcaccaccttatggcatggaagccattcaattcaatcgcacctcggtcttcttgaagtggttacctccacaaccaaatcggactcgcaacggttagtaaatattttaattgttaatataagcttctgagcagggatcttgaacattggtttgatatgataactggtttttggttaccaaaccagaaatgtgatagaccctgttccgattcccttataattgaaccaccaaatagctcggctaaatccactcgttgcggatgagttctcagctctttgtttacatttaatttcattttctctgtccaaccgcccaaatatccccgtggcacaggcatcctcaccagctacaatgtggtcgtcaaaggcctggacgtgcacaatacgacgcggatattcaaaaatatgaccatagacgcggccgcgcccaccctgctcctggccaacctcaccacaggagtcacctactatatcgcagtggcggctgccacgcgggtgggagtcggacccttcagcaagcctgccgtgctccgcatcgatgcacgcacccaatccctggacactggctacacgaggtgagtgggctgcactgggagaaaaagccatttttgtactcgaattaaatataaatcgaaataatatcgtaactaatcacttgttctgtgacttaattttataataagttacattaattcgagatactcgttcagtatgctggaaccttttgttaaaattttatttcacacccgaactttcgccaagtgtaggctttgtgggcatcgggcattgtggagctgctcatttgactgccaagtgtcgcttcggggtccacatcaatccattaacggccaacgacaatggccaacgacttttgcgaccattaaactaagcctccgcccggcacgtacggagctccatcctggatagcgttctcattccgggttctttattgtgtgcctattgcagataccccatcagtcgtgatattgccgatgactttttaacgcagacctggtttatcgtcctgctgggctccatcattgccataattgtgtttctattgggcgcattggttctattcaagcgctaccaatttatcaagcagacctcgctgggcagtttacatggtgagtgaactttaatttaaatttatacttatttccattttgtgcacttcttttggggggggagcttgttctttttgtgtaaggatttacgggtgagttgatgtttaatttactcgcgaaatgggggatgtttagtcgggataatggtcgtagtatttaaggtttaagcggcttaaaaactgtctatactctaaatgaacatttatgatcacagccataagtatcgtttgcgtcacgaaaatgttcaaatatagaatacaatttgcattctctgaatttattttcctatactagtattctacctctgagctccttcatctggatgtactcccctcttttattggaccatctccattccagcctgggacatgcaagcgttttgcttcagctcctcctctccgtaatctatgatttatgactgagcatttatggccggtctcaattaggttgccattttgtaagccacaataactgcagacatcgagacacgcactcataacattgtacagactcgagaaccaaaaccaagggtaataatctttggcagtaagccacagcgccaagattaaaccgactataaaaagataaacaagccacgataactggagcagaagtcgtggagtcttgggggtagtcgtgggaaagggtggggtttatatggcttataagaacgacaaatgctcacgtgaaaatcacatcaattgtctgactgggaaattctaaatatagttagaaaacaagtcgttttagctgactatggggaactagggataccctatgaagtaagagcagcagaatgaagtc

PCR verification status

Line verified as correct.

No slide loaded.