Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT14345 chr2R 5835409–5837513 (2104 bp) Mef2, CG15863 activityactivityactivityactivityactivityactivity
active
malpighian tubule VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14malpighian tubule3
15-16malpighian tubule2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0011656Mef2overlapping BDGP FlyBase iFly
FBgn0033467CG1586311215bp upstream BDGP FlyBase
FBgn0033466Pal111645bp upstream BDGP FlyBase
FBgn0033468CG141815931bp upstream BDGP FlyBase
FBgn0033469CG1213319327bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tatcctcgctcttcggctcacaacaatgcacacaagctgaagccattaggccccaataacacccaaaagtgcgcgccataaagtaggcaacactttcgcgactgctcttttaaaacgccgctaaaagcgcaaaaaatagaaagaaaaaaccatttataggagctgtagaaaaactttctccgctgtttgttcttattttagatgctaaatatagacggaaagtttaaagttgaaccacttccccgttcccacaactgacgtcagtcgttcggctacaaaaagtgcaatatttgaatattcaattaatttatgcattacccagacacacagccatacacgcaaacacacaaacgtagtcgctggttgagtgggtggttcgaaaattccattgcatagccgaggcgcgttgagtgcaaaacacaaaacagagatttcagctcgagcgcctgtatgtatgcactttttgagtgaaagtgtgggtgttcttggtctagttcagtgtttcgtggtcctcagtcttagtcggtgtgtgcgtgagtatctgtgtgagctggccacgcaccgcgaccagcaaaagagaacacgcccccagttggcagccagtgagcgaatcgaccctcgaccaaccccttggttcaagttcaatgcaatcttcacccactgtcgctggcgaccttgaagatttaaccacgcgaagcggaggaagagaaagcgtagggaacatgctagcaaaaataatgaacacggtaaaccccggcaattaaagccagcacgtcacaaattgtttaatttgtagataatatgcaggggataacatttaaagcaacctttgaaacaaacaattgattgctttcgggtttcttttccgccaaagtggaatagccaattatgccagggaaattggcgggaaaccgaggaaaactaaactaattcggtgatacaacaaataacgtttgcctatttctttttttctcaaccctcgtggcttgctgtttaattagtttatgaacttccacagcaaacaagttgtgcaatgccaggaaaatctgaggaaaattagataagaacagatttgaggcgttgtttgtttaaaatatggaatccaacagtctgtactttgtaaaagaattctcatttctactcgcttaaaaacatagtaaataaggtaaaacaaataatagaatgatctctaaatacataacaatcttgaggattgaataacgcgtgttttcattacaccacctggcaaatagtttttttttcatcacacgcgtcgtatgcgtaatattaagagtcaataacaaagggtgtaaacaatggatgaacaaccgaacaacaactcatttaataaacatagctacacacacttccaaatgtcggaaagagatggcgactttagttgaagtcacgtgtaaattccaaatgctgtaaattagcatttattgctagtgggacaactagaccgagctgagaaagtgatacgggccacaggaatatctcgataaaatcatctatactgctggaacttgctccactgtaacgcaagcagagcaagcgacaaaagtgataaacaaacatgacaaaaagtcaacaattcccggtttcaaccgcacacaatccaattagaataagctcgaagagcaatcagaagagcgagggagaaaacggcgagatccccagagagagagagagagctcgcgagttttgcaataataatcacaatcacactgagaaatatcacatagccgtttatatgtatatatattatatagataaaataactaatctcgtgtggaagaattccagatcgatgaccactggtgacattgttctcagtgcatccgagctggctgcataatgacatcacaccagcgataagaacgagatagcctctgagagcgagaggcgcgaaggcggtaggtatatgacatcagcgtgtgcacgatttgttaacagtaaaacgcacgatcactgagtgtggggaagggggtgtgtcggaaaagagggggaccatcgtatttcgagtaccaacgatcactgatcgagcaagcgcaactttcagcaaattttcagtttcacgtgtcaagcgaaaagttggacaaaca

PCR verification status

Line verified as correct.

No slide loaded.