Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT14718 chr2R 6575291–6577370 (2079 bp) stan, CR44452 activityactivityactivityactivityactivityactivity
active
ventral midline VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12ventral midline3
13-14ventral midline4
15-16ventral midline3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0024836stanoverlapping BDGP FlyBase iFly
FBgn0265645CR4445230242bp downstream BDGP FlyBase
FBgn0005586Rab333549bp upstream BDGP FlyBase
FBgn0033542CG1230937484bp upstream BDGP FlyBase
FBgn0033541CG1293437957bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgttttcgactcataaagcaatttaatggtaaaatataaaattgtttcaaatttacatgtcttgctttttcgccctgctcgattcatggcatatgcataataataacttcatatttagttagttttttcatccaaaattttagtttgctgtacttcacccaacaaattcaaagctgacgtattctgaaaatcgacgggctctagactctagtcaagtgtgccatagccaatgagctcgtgacatgagcaagcgattaagggatataagtaaaagcatctgacatttgctagctgaactgcatggcactcagactcgccccagtttttaccaacggacccgaaactaattgtttgctttgggccagaaggccgggcaaactttttcgattacaaaattgtttcggtgcggaatggccggcaaggcgatacaatttttagaaatttccattatcctttcggcatcacgtcggcgtatgcaaacatttgccatttgccaactttggctagccagtgggataaaatggggcgcgatgctggcgcaaactattcaacagtcggtcagcgtttttagtttcatttgcagcagcggctaaagcaaagcgaaagcaatttacacgcatttcggcgcaaaacgaaacgtgccccgccactaaaatgtttatgagcgcggactacgaaatgtgaaatgtgagctggtgtggtggagcaaaggattccggatttgggggtcagcaaatggaagccggagctctaagcccgagctgatgaaatagaacaaagccataaacccgagaagtgaaagcgggaggtcgagggcgaaggcgagggctttccctttttctttttttgtttctggtcagcacaagtcggtcaagagaagtcggagtcgcggggtaggaacccctaacattctttacgccccagggatctgaatgggttgtccgtttggagagtgttgcaattgttttgctgctgcagcacttagcctttacgatccctttagaactgttcatctcactcgaggagaagttgcctacttaacatggccactttcggccctcttttgcagattgccaaagcaatttgaattaggtttgtgattccctgtcgaacgatttgccctggcaacgattctccggcagcttagtgaaaaatgcatgctgaaatcaatgaagcaaaaagcccgaaatattcatggagcacgaattccgactgcattcgctcaaatgcaaaagtggggcttaggggtgcgattaaatgggcaaacaatatttctgccccggacaattgaacatctgaaattgttgcatattttccagcacattccgacgaatttgcatccggcttaaatcgatatagctcagtcttagctttgtgaaattaccaaacttcagctgcagtctgccgttcaatagagtcgacaacaatcgccaattcaagttggctcaactcaactttcgatgcaacttctccctcgcccattgtaaattgaaatactttacccggctaaaagttgcaagtttacaagtttctgttcagtttcacttggtatctgctcataatattttccattaatggcggaaaacttaatttatgtcacgtcccagacatcgtgaaaaatgcgcgttttattttcttgtattttgttttattttacggcaccaggcgacctagtaaaaatattttgaaaagcatttggctggctacgtgatgttcgtcttaaactgcaggatcaactggcagtcacgtgggcgtcgtttaaatgggttccagagctccgaataggaatcgccagtggtaggagtaatggtgcagggttaagggtcgagctatggtgggttaatcaaagctgtctatgctttatgtctttccttacaaaatttctatttaattaatctatgcagggcaggagttggtgaaccttttaaaggaagctagtttaattgaattttattaaaaaaaaaataaattcacttacaatttggtagtaaaaatatgtaacatatttctcatcatgtatcaagtcttaaaaaaatatttagctatttctcttatttctctaccgcccataaaccaaagc

PCR verification status

Line verified as correct.

No slide loaded.