Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT1484 chr2L 2890846–2893013 (2167 bp) lilli, NTPase activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0041111lillioverlapping BDGP FlyBase iFly
FBgn0024947NTPase4997bp downstream BDGP FlyBase
FBgn0028970betaggt-II10139bp downstream BDGP FlyBase
FBgn0051950CG3195011846bp downstream BDGP FlyBase
FBgn0031479Prx600512615bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

agcagcaccagcaacgatttggatccggatccccatatggatatacatatgaaaaaactaactaagccacggtaagtcgattcagttaacaaatttcacctaaaggaatatcccacattatgtcctaataaccatatcaattcaatatcataatgcttatgcgaaggcgccaagttaatgggtataatctaccttaaggttttttgtatcatcatttttggaaaaagggtcaaattaggggattaaatggggacagatatatacttcgaaaaatgaacccaatacgtttagggcccaatcaattgccagcttaatctctgaacatttcgccattgtccgtcggtgacaataaagcaaatgctacgcacacgacatcgaatcggatctggtaaaaacttttcccatttctgcgaagcgaaccgttttctttccggttctgggttctttccccgttttctcattttttattgtcaatgagctgcggcggccactaaaatttataattgaaaattgtacgcccacatttactgcgcacacacacacacacaggcggacaaacaaccagccaaacaaactgactgactgacaaacaaacaaactaacaaacaaacaagcacgggcacaagcagcacatccatataatagatacgtataaagagcagtcgcaccaaaaaataagctgaaaaaggagaggaaaaagcggtccccagttgcttttagcgccatgcaataaacagagcgagagagcgctgccaagttttgcgggttttcttggcctgctcttttccgccaactcagacggttggctgaaaggccacccaccgcccccattttcagccatccgccgtcgtctgttgtcccaccttgaaggaaagtagaaaaatctaagttttcatgctcgtttttccctgggattgaaaaagggtatgtggcaattgtagtattcgaatttgaaagggcagtaaaatcccttcaaggcactcaactgtaattaaaataacaattaagaaaaatgtatcttttggatagaaatgggtgtagaaatggacaacccttgtggaaatacccaagcatccctatttataactctactacagaactgattacagttgagatacaaaagtatcttgaaagtgaaatggattcgaaacgtaggatttgcaactctttagaactgagcacagcgtatccccaagtcggaaaattgccccagaacgctttttctagttagttcccctcctttcttcgcctcgtgtttcggttttgttgtacattttgccggcgtcgccacgcactgtttccccatggctaaaccattgtgcacttttcgctgcaatttgtcgaaaacttggcattttttcttcatgcgaaagtttaaccataacagatttctttagaccacttcctcgtcgtgaagggcgggacggggtcatcttaagttgagctttagagctccctcaaaactcttgagccctcaattgaagctccgaaaatttgccaggctcaagaagttgaatgcagaaaggatgcatagttttgggtcttcttgggctactagaaatgaattatatatgaaattggaaataaattaaagcaaattagaaatatgaaccaaaacggttactttatgactttggctgtctgcatattagttttgtatccacagggtttgcgaacctagaaacatcagaaacaacgagcgaacgaaacgtgtgcgacactctcaacaaactgataaaattttaatttctccaaaattgaaattttaatgtgtgtctagatcgcggtttacccccgttcagcaccccttttatccaccaactcgactgcactttgtgttctcctcctcctcctcctgctgcctggttttcccaccttgccgggaaaatgtgctgctacaccctatgtgtggcacttcgccatacacgcgcacaagttttgggtttttgcgggtttccccaacccaatccaaaccgacccaacgcagcccggtccaaccaccacccacttggctgcccgcattctattgcatttcggtcgccccctctttggccgactttctatcattcgccgcctttggcattggccaaaaagcgaatttgctccgttgcgtccacattatagagttgaattattaaaatttgtctggttgtgtgtgccagttatga

PCR verification status

Line verified as correct.

No slide loaded.