Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT17242 chr2R 11482850–11485013 (2163 bp) CG42524, CG8204 activityactivityactivityactivityactivityactivity
active
head subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14head subset3
15-16head subset3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0260429CG4252418509bp upstream BDGP FlyBase
FBgn0034033CG820421355bp downstream BDGP FlyBase
FBgn0050466CG3046622176bp downstream BDGP FlyBase
FBgn0013762Cdk523929bp downstream BDGP FlyBase iFly
FBgn0024754Flo-125942bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

caggagccgcaatagccgacagtaaaccacaattaaccatcgcaccacccaaccgcagtggtgcatcaccatcacaatatcaccatattaccatatcacaatcgtcatactggggcactcgaaagttaatcacttttattggtcgccatcgccgtgtgggaagatgcctgcttgcagtaaaccgcaaaaatgatgtgcaaaatagtttggaaattttgcaaattgctgcagttgttagcaatcagctgaatggacaatttaaagccaagggaaaagtggatggataatttgttgacatttcatattggctcaaggcttagatggccaaaaaagtgggcggggtcattagggggggttttgcatttgctgcatttggttggcggtttcctaatttaattcaaactgggaaaactgggaaaagtcttgaaagcaacagtggcttaggtatcgaagaacatgaaatgaaacttcttgattaaagatatttatatcttaataccacttagtatatatattgtttgagtagttttagaaataatacattaaggattcttcatacgagaagtatgtgtttctttcacgtttctaacattataggaaaaggaaaataatccgaactgagctttcaccatagattaaaatatccattttctgcagaataattgcagctgaaaatcctgtgtgcacggataaaataggcagaaataacgagacaattttgtgattcgtaggaattttgttcactgtttcctaagtttaccagctgaatatatccatttccattttccatctcctgcaggacgatgcacattcatgaaactgaggcgggttatatgtcaaatagcccacttttggtcttcgactgacaacagcacattcctcaatttcatttcccatttggaaactgaagcgacggcagggctcatagctaaatgcaattatgccagcaaggagtgcaaacctctaatgtaatctaactgcagttgccttttggcctctcgtcctgttcgtccttttgccccaaaccaaaaagcagacaagctgcaacgaataaacatatcaaaattgcatattgttttaattgttttgttaccgggtttcgggttgcgcccgatgcctaaactgcagattaacgcatttacactgcactggattctgcatcctggatcctgggtcctgccacactactctcgcccgcaatcctccccttaccccaccttaagcacacacacacacacatacacggcgtcacgtagaaagagctcctggtttatgcatttgcatgcactaaacacgcataaattttgtgtgcaaccgtaaagatgtctctgtcctcggctcggtgcgttttgcctggtttatggccatggatggaggtggacccggttgcactggccaaatatctgctgaattggtcgatgcattcgggttttatcgataaatgtgttgattatgcagtggaaactacatggaaacgagctattcaatctatgattatgcaatctttgaaatgtttcaatatttttaggccattatgcataattgcagtatttttctaaagtgtatatgttcatgaagggggaaaaggggggggaaacgatcatacattgggtgtgcagtgctctggtttatttaggattcatatttcgataaacaattatgccagtacctgggaggaccgcttggccacatagcatgcgatgcctgtaagccgcctttaaatatggcaagtcgttaaggtaagcccctctgattcccccatgcctccccccgccccttttggacaccagaccgcttttacccgctcctgtgcattgctgtggattttatcccttcttatttcgtggagtaatggcagtggggggccgcaattgaaaatttattttgtgtgctcattttgcacctaatttcgaaggcggccccgaggaaatgagttggcaaaaagaggagtgcaaatgggcagtgctgggggtaaaagtcattttccgtgcctgaacccctcggcatgccgccccgcctgctcctttgttccttcgtttgttgtatatttattttagatttattgtaatgtccagcaaaaagattgcccaactggccttagtcctctttagtttcttctggcccccgatctgccttatccttggctcccctctctgctgtatcg

PCR verification status

Line verified as correct.

No slide loaded.