Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT25717 chr3L 4796096–4798402 (2306 bp) RhoGEF64C, CR44528 activityactivityactivityactivityactivityactivity
active
head epidermis ventral subset, antenno-maxillary-labial complex, midgut chamber VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14head epidermis ventral subset3
13-14midgut interstitial cell1
15-16antenno-maxillary-labial complex3
15-16midgut chamber3
15-16midgut interstitial cell3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0035574RhoGEF64Coverlapping BDGP FlyBase
FBgn0265721CR445285813bp upstream BDGP FlyBase
FBgn0035575CG75096981bp upstream BDGP FlyBase
FBgn0042131CG188089957bp upstream BDGP FlyBase
FBgn0261797Dhc64C11272bp upstream BDGP FlyBase iFly

UCSC snapshot

UCSC snapshot

Sequence

caattgaatcgagcacgcataacgctagttagtgtttacataatacgtatacctatatctattatctataccaataccactacttatactatgcataaccatacgtacacacgaataccctgaacacaatgcaataaaataccatacactaattaaacacttcaaattgcgtaataattgagaggctatttgtttctggacttgcgtcataaatcctgcttgcggcatgtctattgaatccacctggcgagtcgaggcgttgcgaggcgcctcgataaatctcacagagctgaattatttttaaatttagcacccaagatttatggggcatagggaaattatgcagggcatcgaagcacgcacgtggcccagactaaagcccaaaacaatcagaatcactgccgaaaagtgcttggcccaaaccataaagaatggtaaatattttcggtattacaaaagcaaccgtaaagagtgtgcgacggagttgattaaaccattttaaacccatgaactcatatttggccaacaataaaaacactcaagtggcaagggctccggctttattatttgtttaattacacaaacaactgggcagattattatggttaaacacgaaacggtaattgttatgaccagcaattgctgcgacaattgtaatgggcaaaaacgaatataaatatgtgaactggctttggttgttgagcgagcactgtgtatctataactgcggtaaccgctgggttagagcctaatctattgatatattttgctaatggattttcgaattatattcagtattcatacacgtaaaaaaatgaatatatttaaatttaattactgctttatggtgttgtgaaaaatagccatgccaacaatcagatactaagataaatagctatgcattctaacttcaaacttcaagctccttttcgtttagtgtagcacacatttctgggcagtgcaaagttcttgttattaacttttcattactttattagggcaaagaatttcattataaccacagctatctagattccaattccaggcattcaacatgccaaatgtttaatagaaacactcgaactcgtccattttcccttttccctgtggttaacccacataaacaacaacactgcggacacgttgatattagttcggttgaggcaatgggaaaattatttccagactcgcctgcggcgcatcaaagcctttgatggcttccgttgtaaattatactaatacgccacgtaaacaagttccaaatccttaaagctccgcaagaaggcaaaactagggaaaattgaaaaatgacggtctcaggaaaatattgtagccactgcctggaaaagcaacagcaaaagcaaagccaaagggaaactgcatgctgagcgcaattatgctggacaaacatttaccagtcaggcgaagcacccacgactgatgcacagagaaaaaatttggcgacctgataaataatcaatattttatgaaaatttataaggaaattaggcattaattattgtacaagaaaatatctagacgcattcgtgtctcacattttcatagcttggatgtttggtactaaagtgttgtaaaaaatgttcaaacatttgttttacttcgaaagtaatttctctcagtgccccgcaaacgactggtggcaggtggaaatgggcttggaggtcggtacttagcatgcaccttggcacacacactccaagcccatccgatggcactactttcagtgttcagcttcgctgcttgccaaacacagacagagtcagagtcagagactcgtggattcgaaggttcgagggttccagggatcagggattcagggatgcagggactatggcccaagtcagctggagatgttgactaggtcgtgaacgtgttataacaatagggtgtcgcgatgggaggtatggatgctgcaccaaccagcgactaacactaacgagcagttaaacaagcttaagatttgccgacgcaaataaaaacacagccggagaactggtgtggccgggccacccagtcgagcctcccagcccggcaaggccaccgccaatcccgcccagaaattgctgccaagcggaacagagcggagcggaagtaaggatcggcttgcaataacataaccaaggcacgtagcacaaacaaggtacattatattgtataagcagacttcattacggtatttaaacagaatatccacaaattctgacagcccaactgggcaccgtggatcgaaagcccaaaattaaagcaggatattcagtatttggtgtttagttcgaggcttccctga

PCR verification status

Line verified as correct.

No slide loaded.