Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT33043 chr3L 18920938–18923123 (2185 bp) CG32204, CG43049 activityactivityactivityactivityactivityactivity
active
anterior ventral nerve cord broad, ventral ectoderm anlage, brain broad VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10ventral ectoderm anlage2
11-12anterior ventral nerve cord broad3
13-14brain broad1
13-14ventral nerve cord broad1
13-14anterior ventral nerve cord broad4
15-16brain broad1
15-16ventral nerve cord broad1
15-16anterior ventral nerve cord broad4

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0052204CG32204overlapping BDGP FlyBase
FBgn0262351CG430491731bp downstream BDGP FlyBase
FBgn0036833CG38195731bp downstream BDGP FlyBase
FBgn0036832CG182237520bp downstream BDGP FlyBase
FBgn0036831CG68398580bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gcatagaggaagccgccaactttttacatatgtaacggattcggtttgatttgttgtcctcgacggctttttgtaatttatttgcttgccttagctgacttgaagcccattgatttatgccgtgcgccgagcggcggcgcaattgatagtctgcttatgcaacaaggacctcccgatgggcccgaatcctttgtgtgagatgttttccattaaacaaatggtctccccagcactgcgctatgaaaacgtcttcgatatgcattaaaaacatttcaccctggctatccggggatacgatggaggagcactcaccttatttacatggtcgcgcaggacattggagtagaccatggcgacagcttccagggccataaatgttatatagccaattatccagggtacaattagtcctgggttctcctgtggaaggacgaaaaaagcggaaagcaccttaaatatattgccattagaaaataaagctaaaagggccaccgaaaccagtacctgtatggaattggaggtattgatttcatggccgtactctaaaatttgccaggatgtgggtgttaaaaaagcgtgagtgcggtgcaatttatctcgccacggtggcgaaacccctgattggattttttggggttttttcaatgtgctaaaatttttactgagcacgttgggaatttctgatgtgcagctgacagtttttggccgcagcggtttgcatggtaattttgtgggggcatgaaaatgtattttaccagcggattacattttaatatgggctataatgcttgcctaatttttgaaaatgcaattaatcccataacgaacattctatttaagcaactgtagtaaagggaatttgtgaaatgagtataactatggttacaagctagttttatttaattattactttagttgattgagctgctcatttagtacttattttgtataatttaatattcgtttgaaaatacatgttcgttttgagatattaaagtataattttaaataaatgttaatgttttaatactcattacataatgtatagttgattgcactgaatttgcatttaatgtttaaataataaaagagataattgattccgtttttcaacttaaaattaaacaaaatccagtgttttaaacaatatttcctaggcattaagtttccttcattttcagtttcaccgtattatccaatttatttgcagagttcgaatgctgaaattaatgcgtgtgttttgaagtcaagccgcaagagtccttagagtccaataatgaattgtttggctattatattggctatcaaccgcaatgttgtccaaaacttttgctctttcccccaacatttgttgtccgaacgctcgtttagcctaattaagaaccaatgctctatgcattatttaatggccatctgctgcgggcttttggcctaagtgtctaagaatagggcgccaattagcgagctgcaattaatttaaccatttagcggacttggttacattttcattagcactgggcagcgccaacgatggcattcattttcgtcgaattcacgttccaattttgtctgtcagcgtcaaaatgaaaaaattccacaaaatgtacccgaactgaactcggtctatgcaatccttctcaagggtcctggcagctcgtttcgcgacgagtcagtcagacttaatcccattcctgtgccaattgtgtgacaaattgtccacattttcatgccgctgtcgatggaatgctggctttttcacatttaggggagttccttttcataccacaaattttacaaaaaaagttcaacattttactatggcaatatattagtaagtgtaaagctatacattccagaaaaattgtgttctttatttaatttgaactcgattacattttatgactaacacgattacaagattaatgtctgtttttaattgtagcactaaaacctaattttttgagtgtaccccatgcacagcatttggcgcccaacaaaatcatattagaattttggaagcaacgcggtatgaccgctttcagtaatttacatttgaatgcgctttgtttgctgggtaaatactttctgactcaaaggctctgggaggcacaatgcgccaaatttgcggatatttgattttgagtatttcgatctatgggcgggattggggtggaccattattgcct

PCR verification status

Line verified as correct.

No slide loaded.