Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT38334 chr3R 4106498–4108730 (2232 bp) ato, CR44318 activityactivityactivityactivityactivityactivity
active
brain anlage subset, brain neuron, procephalic ectoderm anlage VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8procephalic ectoderm anlage2
9-10brain anlage subset3
11-12brain neuron3
13-14brain neuron3
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0010433ato1503bp downstream BDGP FlyBase iFly
FBgn0265377CR443186393bp upstream BDGP FlyBase
FBgn0037562CG116717100bp upstream BDGP FlyBase
FBgn0037563CG116728619bp upstream BDGP FlyBase
FBgn0051464CG3146410464bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

atcggtcgttattcccgagcagctactccagctaccacctgcatgcagctgcacagcacagcagagattcggagcctcgaattcagatccagcttccaaaatgcaactgcctgccaatacaattagttagaattcatgaatggcaactcgaccccagtcgagttctggcattctgacttactggctcactgcgtttcggcattcggctttcagctttcggcctttggcttttggcagtgccgccgacacagcagcaacatcacgccggaaaacaggaggagcagtagtggcagaagtggcagaagtggcagaagtggcagaagcggcagccacttgcatgtctttgtcaatttatagacagcttgcctgagcattattaacacgtattattacgggtatgcattcgatgtccgttgtggggctgcatattttgtgggtttttctggccgttcgaacggggggaaacgaatgcccccgaaatttgtcatgtcgataattggcgagctttattttgaggtttttgaggttgcttatattttttgtgtccgacgctttggttagttagtgcatctgtatctgtaaatgtatgtacatctgcgttaagtaacttaatgagctttaacaccatcaatttgtcacttcttgttagtgtcgccatggggcagtatctaaatgggttattgtaccgatcgacttgcatcttgttaagtggtaaggttttaaggctcgttatgtgcagactatattggtcttagctgaagttcaaggacttaagcagtttgctcaacaaattgaaagaattttacagtggagcaagtttttatagattaaaactacctgaaaataaagcgaaataaacacttaggaaacaggtagttctgacaatccattgtgccccgtaagattcaattaccccaatgcacattttttaattgcggttttggtatgttttgaaataatttatatgctatttctatgaatgtttttttgttatctcgctcaatagaatttctcatgcctttttgggcacaatttccctcattttcgaaagatctaaccacaaacattactttgtatctttttttgtttatttctcaagtgcagtttccgtttccgccgatttgttttggcattgttgtgtgaacattttgcgctgatcctttaattgttgcgcaaccttcgctggcgaaattgcaggaacccaggtccgcagcccacggtcccaaggattcggtgattaatgccggacctttctcccaagtcgcgtgtgcagcgaaattagtgggatttcgtattgtgtgtgtgggcatcggcatccgatcggtttaagccaaactcaaagtccggtccaaatgaatgcaattattaagtcataaaacggacaacgtaaaatgccaaagtctgtaattagcgacaccaaatcacggcagccgcgcccccttttcttaatacatcctttctcagcccattatcgggcattgtgtgcggtccgcgaggaaaggagagagattacctggcataggaagaggcagagtcctctggaggtcaccgtttgttttgggaagtcctggcccacaaggttagcggcaattagtcaaacgattcgcaacgcatctaccatcaatcaacgtagggccatgggctccggttaccgatcctgatcatcattatcctcgtcctcctcatcgggagcagtaacaaacttaaccgttacccatttgacaaataattcgcacggccaacggcccaaaaatctctgggtaactcaattagccacacagacgatcggcacggcacacttgactgactttcggtttccaaacccaagagtccagattcaggacccaccaagttggtgggcatcccaaagaaccaaagttctcagtatctcacgctgcagccaacggtgatcgaagatcgacagtgaaagtgcatcagaaatcaaagtcgttctggattttttgacaactttttggcgaggcatcaaattaacacaagaggcaaaaaccttaaaatgctaccaagacaaggcacagagcaaacaaaaggcagctaagtgaatgcattttaattatactctactatttcaaattaaataatgcaattaagtcacaagataatccttgttactttttattacccatagtcgtactaaaataggtttcgatttatgatttagatttgattttttgatttgtagcggtagagtattccgcatttggcaacacaaaaa

PCR verification status

Line verified as correct.

No slide loaded.