Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT40613 chr3R 8478468–8480341 (1873 bp) CG6234, CG6225 activityactivityactivityactivityactivityactivity
active
head subset, gonad, proventriculus VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14gonad2
15-16head subset3
15-16proventriculus1
15-16gonad3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0038071CG6234overlapping BDGP FlyBase
FBgn0038072CG62251831bp upstream BDGP FlyBase
FBgn0038073CG1439510085bp upstream BDGP FlyBase
FBgn0038070CG675310265bp downstream BDGP FlyBase
FBgn0038069CG1160812714bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgaattgaaacgaaagcatttgccatactgtttaattttaaatgcactttagccactaagaatttgcaaaagttcgacaaaaatatttatatttagacttttatagagttaagctcttttttattgtgtctgatggaaagtcagaataaataatttcgattggtcaacgtgtggagtatcttttgggcggttttccttaagcttgttgcatattttttggctgagtaaatgattatgtatgaaatgtatgcctattcagttcattcataatcctatgcaaagaaactgaatctttattttttttttgttttatatttatgtcgactatacctttagtaaattaagatagaccaaaattaaatgaacgaagcctgcagctagaaaaactttgatatttgcaaggctcttagttaaataatgttcgataatattttggctgctttggtaacagtttgacggaaatattctgcaaaagttattgccattttggcatgtcataaaacttaagccaaaaaacaatgccatgtatattaactgtgtaagtgatggccaattagtgaaaaagctagttttctgaggctaccatggcagttaagttccgtagtttagcctccgagttacaaggtgcatatttgtatgtccacaactacccattggaaaactgttgcattatgcatcggaaaaatattaaatgtgtgattgctttgaagtcagttcccctgcccctcaagtcccaagattagactaaaggtcaaccagaaatgatttacggctaagctacataaaagtcagaagaaatggcacccgcacgcctaattgcttgtcaggcgtattgatcaaaagctcttttgcgggcattgcgggcggcgctcttcaaagtcgatttttaattagttaataacaaatggagagcagggcgatcagagagcggcaatattacttactgctcgctagcaacataataaacaagagcatgctgaactcccacccgtcttcggtcggcactcccatcatttcaaatgccgctccgcttttcatcggaaaatcgagtggctgtcgctgtgtaaatgagcttaatgagcgaaatgaaaaggcgctcgcttcgtgaccgaatgaaataaacaaaacgattttgagattaagagctcgtcaattcggatatgtatttgtttacgccggattatgcaagcgcccgcacagtggtcttcgatttcgatttcggtcgcccgccaaagaatcaatttaaaagccataaaacaccaattgacagccttattttctcgattccatcgaatccaagagtcaattgcttaagtcgaacgccctggattggctcacttggaaatccagcgactcaacgacgtcattgtctgctcgacttggcgaactaaagtgaaatgttagccgctcaaagtcgccacaagtccattgtaatagccgggattgggttgccaaaccatccacggatgagcaaccacgaccactgtgctgcaggcgagaagaggagacttttcccattttcttccgcacttttgtctggcgagcgtctaacgccaaagctcccgctcgtgcgcctttcgctcagctgttccgcttttcccgccgcattttccgccgcttttcctcctgcaccccaagcacttatttttccgattaaaccgtctatgcatgcatgctagctagtctagtctgtctctttccctctcactcatacttactcactgtccctctcccttactctctctcactcgctctgtgggtgtgtgccagcgctttttcatctgccacacatttcgaaaaaaacaaaatagcaacatcaaaaagttttttcagtttgcttgttgctttacacgcgtgcggttcgcttggatttg

PCR verification status

Line was not verified.

No slide loaded.