Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT40973 chr3R 9156666–9158827 (2161 bp) PK2-R2, PK2-R1 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0038139PK2-R2overlapping BDGP FlyBase
FBgn0038140PK2-R17386bp upstream BDGP FlyBase
FBgn0264991CG4414217775bp downstream BDGP FlyBase
FBgn0052473CG3247318160bp downstream BDGP FlyBase
FBgn0045442mthl1222729bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgtttttcatctacagcaggcatttcacaaaaataatatatatgtgtattcgcatgcgatacgatatggttttggcttacagccacagccggaaggcaatggctgtaaatttgattgcctaaactgagtcgaacctcgtaagggattgtcgctgtttttatcatgctcttaaattttttgtaattcacaaaggctctctattcgaactttctatacggaaaacacataatgaatcaaaggatcaaaggaccggttctacgaatcaattaaccaggtaactcataactgggggacatacgattaagggtctcgcatcaatcatacgcaccgtgcacgatgttcccatgccctgcatcaccacggagaactgaatggcttggggcagggccagcaaaagggcagctatccagatggcaaatatgaactttacggcccgtgacaacttggacatcgtgtgctgcctgtatcgaaagcagaaccaattaagcaagtttggggcaaaatggaaatgggcagtggaaggaatgaaggttcccttacctgaacggatgacaaatggcaatatatcgttcgactgtgaacgcggtaatggttagaactgtcgcattggccgccgtttccgagagaacgctctccaatatgcagatgctgtcactgaaaggataattatccgggtgccagaggttatagaggtcctgcggcattcctaagaacataaatagcaaaatagcaaaatatatagtgtgattataaatatttaataatagctgaaattatagcctatagcctcaaaatgcaaatcgatttgagcatctgccgaatatctcactctacattttcttgtttatttacaaattttaatttaatatgcctcagttccatttattgtttgcactactgaactgaattaaattataattcaaaaaccatgaacattttagttttgcactcacctgagcataacaaaatcatgtcggatatagcgaggttaaacagataaaagttggtggccgtgtgcataaagttgttccgcgaaatgacaatgcatgtgatgaggttgcccaaaacgccggcgataaatatgagggcgtagcccacgcttagggtggccagcagtgaaagtggtgtcatcggggtcaccgtgggcaaaagctcctccggctccaggccctggagaaggctggtcaggttgtccgcggagatgttcagcacttgtgtcagatttaagagaaatttctcattgtgaaacagttgtagatcggttgccaggacaccggaactgttagtgggcagcattttgactgccatagggtgtgtgtctttgtgtgtgtgtatacgcactattattttcgaatttctttggaaatttcagacttctgcgtatgtattctcaatcgaagctttcgcttgcaaataatgttttcataacgccccttacgggggctcatcaatttcgacttaggccagagccactccacttgcaatctgttgtcatgagtgtgggattaaattatgtgtacggatgtgtgtgataaggtggaccctatgtgctatttaaataaaactatgtttttcaaaatttgttaaaatttaaataaaataatacaagacaaataacgcattttaacgaatttagtaataaaacaaattcaaacattaaggctttttactccagatttctaaattaccataaattatacatatacacaatttggttggtaagctgtgcgctttgtttagcttgctaaggtccaccttagagagcccgtcttaaagcgtgtttgtgtcctgtgtgtttacctggcatcctgggaaactggcaggcggcagtcaggcgtgtcctaggcgaaagaccaggatcagggcgagtggaagctgaaaattaatttgaattgctaagtggcatttagtcaaaatatttgtgtacactggatgaatttaaggatgttgctacaaggctgagaaggacaggcctgccgatccgtctcccacccaacaccaggtggcaaacgaatgaaacgagccagaagctcaaggtcaggtggtggataagacggataaggagacgacgatggcaaatggacaccgggtgacttaataacattaacatagtttcattccattcagatgatgagtgttttcggctgctgctgttctgctct

PCR verification status

Line was not verified.

No slide loaded.