Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT41025 chr3R 9253723–9254673 (950 bp) Act87E, yrt activityactivityactivityactivityactivityactivity
active
somatic muscle primordium, somatic muscle, trunk mesoderm anlage VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10trunk mesoderm anlage3
11-12somatic muscle primordium5
13-14somatic muscle5
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0000046Act87Eoverlapping BDGP FlyBase
FBgn0004049yrt866bp upstream BDGP FlyBase iFly
FBgn0038153Ir87a4862bp downstream BDGP FlyBase
FBgn0261814CR4275610586bp upstream BDGP FlyBase
FBgn0041711yellow-e12718bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgctgaaggaggagttgaggagacacaagaatgcaaaattttacagttttaaaaataaattatactagcatcctctataaattaaatctaaattttaaacgaaacgtatcttttattcgctgcaagcggcatgctatgcgattatttttagcgacgcacaggaaattacgaaattttgcacgcccactgcaaagagcgaaatctggaggtggatctcctcgactggggtgcacatacatatgtacatatgtggctggggatgagcacggtaatcccagcatagacgcctccaagacagtccatttttgcccattgccagtcggtgcaggagctgcccccctcgtcgtggatctaaaaatacagaccaaaggaaacaacaaaagcggcaaatcaacatgccgaagtattaacaaatgtcttctaagactacagtcaacccacagtagattgaacaaatatgtgactttgaatgtcagaatatcaactttaaagggattcgaaaatatatatttttaaaactaaactaattaggaatacaagagctcgctgaaaacagtcttcgttcaagacctagttaagtatattttaggtatgttccactgtaacaatgtgtgagatggccgtttttttggagttaacatagccgctgggagaagcgaccgccggctgtcttttaaattgcagtgccacgacctcgggggctgcaaaaatatcttggaatttcaagtacatttgtgtggctggtccgggacgcttgtacttgaagatcgagcagacagacgacaccaggcagatgggcctcctcgggactcgggattcctggaatggggtgcccaaatcgaaaatagacgagatacgggtagggtatgttgtactgtatacatgatgcataaatgcactttttattgaatattttatacatttaaatgcttcaacatcgttgctgtatgc

PCR verification status

Line verified as correct.

No slide loaded.