Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT41689 chr3R 10508753–10510847 (2094 bp) Meltrin, kibra activityactivityactivityactivityactivityactivity
active
dorsal ectoderm AISN subset, procephalic ectoderm AISN, dorsal ectoderm anlage broad VDRC

Annotations

stageannotation termintensity
4-6dorsal ectoderm AISN subset3
4-6procephalic ectoderm AISN3
7-8dorsal ectoderm anlage broad3
7-8visual anlage2
9-10head epidermis dorsal anlage2
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0265140Meltrinoverlapping BDGP FlyBase
FBgn0262127kibra14658bp upstream BDGP FlyBase iFly
FBgn0038252CG350918210bp downstream BDGP FlyBase
FBgn0025808Rad1719835bp downstream BDGP FlyBase
FBgn0038251Hexim21855bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ggtggattaagccaaagaaaggggaacgagataccagaaaaggtaaatagtaaccatatgccatgactaacagctgtttggccaaaacaaaaggcaataatgcgaaatgacggacaaaaatgcaggaaaaactggcaactagaaagagtaaaaacaacagcaaacaatgattatgctgatgaagactcaattcaggccacaaagccattttgctattatcattttggtcctatcagataccctaccttctaggccaaattgttttcagaagcatcagataatctatcttacaattaaatgtttgcataacatcaaaatcagttttctatatacttgatctaccaatcatctatatccaacttgcaatgtaaaattgtagttaaaattttatgaaagtaaagagaacttttagtatatactcagaccgaattgtagattatattttcgataaggattgtagtttcttttgtcttagattattatttgggtgtgttttcgctagctgacacaaattcccagctctcattcgccattaaaattgcaacaaaaatgaatgtctggctaaaaataaatgtcagactaaagccaaggggcaacttaaagaggcgattaccatctgttgcgggtgactcactactgtgaatagggtcggtaacttaagattcgctgccttttgcgtgcaggaagtgtgcttccatgcgatggcttacctgcaagaacaaaagaagaaattattattaaattagcattgcggaaaaggattaactgaaaggggtacccagactgcgcaccgcacttattcccagtgtcgaccattatgattaataaccacttattgtgcggcgccgcgacaatccatctacagacaagatccagcgcggctacaactttcccaagatctgtcagttcaaaatcgaaacgcacacgcgtttcaaataaatcatacaagtcaagatcgctgcctctttctctctgtttcagtcgatttttctttgcaaaagtgtgagaaaaacaagttcacttccaatgggttgcgtttggtttatgggctgggagatacacagtatacatttcatatctatcacattaataattaataaatattcccccagtttactcatttctttttcttattttcagtttaatattttctacatttctttaaaggtcattcaacaactagcattctcgtttttttttcagtgcagcctcggctccttgtcacaacagcaattaaagcccacaacttgttgttgtttagcctcaagtgaaatcgatatcatttatcgcatagcggaaaagtggtttcgggtgaacatttttcgagtcgagtttgggcggtctgtgggtttcacatttgccattttcaccccgcggctgaaagccccccgtcttcacaaactttcttgcccaccgacggcagacaacttttcaaggtcgttcgcttggttaagctgaattttgcggtctccgatgtaaagtgcaaaattttgccaattaacttggcgaaaagcaacaaaacaaaaacatcaacggagaaacagcagacattttgtgaaaatacatgcatatatagggggaatatattccagagatacagatatagatacagatagggttgcaagtaagatacacactcttgtttacccccggccaaaatttaaagagccaacaagttttataatggaagaaatgagcgggctcgaaaaaaaattaaagcaaatttattttaatgatattatttacttttatttttatttacacaagctgcatccaaactcgaccatgttttttaataaaaataacagcgaaacagcattttgcatctgtgctatgtttatttatttttctttaactcattaccaaaaacccataaaatggctatgaatagaaaagtgttgtgcaaaatacaaatccaatttggtatccattgtgtttttaaacacctagataggcaaataaatacgtgaattcaaattgtcttgtgagttggtaaacttttatgagaaggcagctgaaaatttgtgaaatttgcactttatttgcatccatatggtcagtgagcaaaccaatttcgcattcaggttcggtggtg

PCR verification status

Line verified as correct.

No slide loaded.