Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT4454 chr2L 8851851–8854097 (2246 bp) CG32986, CG32987 activityactivityactivityactivityactivityactivity
active
dorsal epidermis subset, dorsal epidermis primordium subset, head epidermis dorsal subset VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12dorsal epidermis primordium subset3
13-14dorsal epidermis subset4
15-16head epidermis dorsal subset3
15-16dorsal epidermis subset2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0052986CG3298610925bp upstream BDGP FlyBase
FBgn0052987CG3298711960bp upstream BDGP FlyBase
FBgn0052988CG3298813013bp upstream BDGP FlyBase
FBgn0052983CG3298313999bp upstream BDGP FlyBase
FBgn0032072CG948314916bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cgggccaatcaaaataaatggctacaataatcaatcaatttaaatttagggtgattatttttaaaatgtaatagtataagtattaaatgatatctagttgttcttaatgtggccaattttaaatattatacttacaggcacaagaacgtcccatttgtataaaatgtgcgtgctatgagaatagccgtgcatgtgcaaccataatccaacattacatggctcggacacccttgaaggtccttcaagaagtgctcgtcagccgacatgtcctgagtccttgtctctggctcttggcaggcttttatcaggctgtttttgcggtagagcagtcctgggtgtgcggtgtttggtatttggtgtttggttacaccaccgcagtccaagttggaagacttggcagagatgagagacccttgggctcggattcccgggttcgtcgactgatgttgtaagtaacatattgtgcgagcatacatacttatttatcgatggacgcgtgtctgtttattaattgaagtatttgttcagtgtgttgtcgtcatcggcgtcgccgcctgtcgtctgtttgtttttccatggttgttgtttgtgcggcgcgtcaacacttgaaatttgaaacattcccactgccgcacttcttcttttcgggttcgatcgacttgctacttgtttacattaaccaattagcgtgtggcgggggttggaatatcaggttgggggttaagacctttgacatcgcattgacatgttgcgactcatatttgttttgacagttttccatagtgcgggggtgtacgtgtgtgccactgcacaactgacacacaagccactagaaaactgtcactttaacctacgcactttcggaaaactgtcctttcgtcctatttgtgtcaggtgccctgcttcgatttcaatctgaatgtattattggaaatacctacgaaagctaaaattattaacgtcattacatgacagatgtatatatgcaaaactttcttttttcacaatattacttagttttgtttagaaagcgtaattccataagtttgttcaaagagtggctcggtaattttccttagcgctttgcagaatgcgaaccgactaaatggttgggaattttcctttctccatcctcctccaactatctatctccccaacccaaaacgatggaatcccggtgccttgcggattggtttttgtgttatcaaaacaaattgcactgccagcagcaggcgcagaatcgccgaagattggggcaggaaattttatttggcaaccccgccacttaacccgggccccaaaaccctccagaaaagcagaacactcaccttttcgcccgtcggggccacatcccacataatgatgatgcgcaagtgtcgcgtgcaccttttttccacccggattctgtgatggggttgcggattggggatggagagcacagaatacaggactcaggatgcgatgtattagccggggtgggtggggctgcggttgggctgggatgcctgcaaggagattggccataaaaattccgtaaagatagcgatttatgtggaaaagggttggcaagtcgatgcgtaaattgatgtggcttctgctgtaatggcacttctcatctcggcatctctgcaacgcggcatcatcagcatttgttgctgacattttcgctacttagtggggatgcgagatttcggaaagtatatatattctttttcttgtcaatcgtggggtcttttgtgtggggcgcagtgtggaaatgatttgcaggtggttattaatcaaattaatgtgcttattgataacgggctgaatggcacgccgtaatgttgtcgcctcgccattgttgatgtttgccgctttaagtggccgaccagacgagtgccttcagacagacacacattttacaagcttttaaaaacagattatcttatcccatctgaatggaacaggaacaacacggggccgcacttaatagaaacccaattccgaagttaccaaatttacattcaaatcaaaacgaaagcgccgcctaggcggtggggaaagtgtagaagaaccattccgaatccgaaaacattggtaatcattccggtcgactctgaaattgagacatcaaattggttagggatctgaggaaaaagccacttaaatcacctcagagacaagcggcgagataacgagagtaaaaaagaaaccacaggcctgaataacccgaaaacaaatcaagtgcctcggtcggaaaaccta

PCR verification status

Line verified as correct.

No slide loaded.