Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT46785 chr3R 20248536–20250798 (2262 bp) nAChRalpha1, CR43455 activityactivityactivityactivityactivityactivity
active
head subset, proventriculus, brain primordium broad VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12brain primordium broad2
11-12ventral nerve cord primordium broad2
13-14brain broad2
13-14ventral nerve cord broad2
15-16head subset3
15-16brain broad1
15-16ventral nerve cord broad1
15-16proventriculus3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0000036nAChRalpha1overlapping BDGP FlyBase
FBgn0263409CR4345517053bp upstream BDGP FlyBase
FBgn0039200CG1361629053bp downstream BDGP FlyBase
FBgn0039199CG1361530945bp downstream BDGP FlyBase
FBgn0039198CG576832476bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gactcaagatttgcccaagcaaggcaactgtaacttaaaacttttataactgaaaaactgtatactcaaaagtttgctatcctcagttttagcctttttccttgaactccgcaaaagttttgcgcaaaaaagattttatgtgtcagctggaaaagttttccataatttgatgtgcacatagaaaatcgtatgtgatgactcagatggagggtgaaaagaatgtcctcggccaattacatttatcaatttgatggtttggcaacgaggctaaattaattatgctaatacgatgtgtaaattgtttgtaatttgtgcattgattccattaaagtgcggctctctttcgacccgaaataaatcaaatcacataccgacgtctgcataattcagcacaaaacacgtgtcagtgaccgcagagcagagcaaaaacagcagagaaagaaaaaataataataataatattagctgggaaggcaacatgacatatacacaaaatggcgacaggacaacgaacaaccaaacaacgaaaatggcaggcataaacaacgacaacgaaaatgaatgtcatttcgagggctatttatgcgcctcttagttggcagattatttcattttcatttccatatgaccatttatatttatttattatttatactttccacacacacgcacgcacgcatacccaatttctggccacaatttggcttgctgcggctgtcaacgctgcgtatgcgcaattatatttgctgactatatattaatatatactgaatgtcagctgtgtgtgttcgttgtgtgtaaacttttttgttagagcaatgctcaccataaaaaccagacgatgacgtgtcctgcccccgaaaatagctctcaaagccattaatgaaaaatgtaaactgcaaaactttctcatggaattttcgctggttttttttgtagcgagagttttagaaggactgcgattgctggtcgactgcacagtggagtatgtattcagcatgtgttcatattaaacttgcataatattttacaagttttctactaaatcccttttatttccatttctataaaattatagattctgattatataatttcatcttggctaacaaccattacgattgtgtaaagttcccgtgttacaccactgttcacaattttaattccacaaatgtttcttctccattttggttacacggagttggcagtataatgaagccaaaaactgacattgactgcgggccacaattttaattgcaatcggaaaaggaccaaaaaaaacatacatagataaagagaagagaccggcttattgcggaacgagcttgatttcagcacttggaagacaaattctccgctttttcgaaaggggggatctgtgaaattaacgctcggtgcttcatcctcatttgcggggattgaagtccactacgaccggtattaagtgcagcagaagcaatatgagcagcagttcaggttccccgccaacagcagaacaaattgttatgtaattgcccgatgtatatattttttgtatatacatatatagtctagatacacaatccactgcaacactgccgcacaaaagcaagcaccgccatcctattttcctgcttgctgccattttattagcacttgttggtcgccggaggggtggtagcatataaaaataataagtatcaaaaataactgaccagctctatggccgtaaagagaacgagacggacattgaatgcactcgacgtgtccgacggcggctataatttcaatcacttccccagcaaactgaaactgcagcagaagcagccaaaatgtggcattaaaaacactcgtaaacgttgcaggatcacaggactcaggggtgcggaagagcggactggcgagtaagccgagctgaggggtggatttcagtgtatccgctttctctgctcaattttttttttctttcgctttttcacccgtttgagtgcagccagcgaaattgcagcaaatattgaaagagaaactatttgttagctagccgtcaatttgttcgtaatgagctgcggctgagtccaaagtccaggctctttgttgttggccaacttttgttgttggtgcttttgctgttgctgtgatgtgccacaaatgaaaatgtctttcagcgtggtaaatattttatgtcatttctgtgcacgtcttttgtgcgcttgcttgtagttgcctgggtgcttcatttttgttacttttctttttttgtttggttcggcttgttgttccctttt

PCR verification status

Line verified as correct.

No slide loaded.