Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT49500 chr3R 25487630–25488578 (948 bp) Dop1R2, ppk21 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

No image data available.

Neighboring genes

gene IDgene namedistancelinks
FBgn0266137Dop1R21925bp downstream BDGP FlyBase
FBgn0039675ppk212871bp upstream BDGP FlyBase
FBgn0039676ppk204906bp upstream BDGP FlyBase
FBgn0039677ppk307241bp upstream BDGP FlyBase
FBgn0039678Obp99a9749bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gagtccttgctgcctgcctttcgtcctgccatggattggatataaacaaaacacctttccgttggccaaacaagtcggcagccttggccgtttgacagcccatcgatgggaggtgggcaaatctttgctaaccgccggaaacggaaatggagaggaggaggaagcagaaggcagcagagtaaatgttgcaaatgctggcccatcaatcagccaaaatgctgaaatggcaagatggcaagatggcaaaatgggctcatggctggtaatccgcgtaatattattaaataattaacacgcgttactgcgccttgtttatgacagcttagcgaccggaagtgatggcgcccagacttttgtcttccaagatttagccatcaaaagataaacgcaattacggagcagttttcgagcattttggaaccgtacgaaagacaaagactttgcggcgcggcgaaacatgcaaattagcgtgccagcgaacgagttaaagttcgcttttgaaaggaatttgcatatttaaatggcatttgcgccagacacttgacagtctaactggcagttggcaacattcactgggtcctggtcttgctgctcctgctcctgctcctgctccttgatcctgtcactccggtgacagtcggtgcctcgtcacgtttctgttggctcataaaagtgagattgaattttgaacgggtggcccacgaaagtccctcctttctcattcgcaatcgccctaactttctgccatcccgggtgtctgtgcttaataggccacatgaacttgaatccaccacgccacgaggagatgatgatgacgcctccgacgaggatgcgaaattgttgcacacgcgcaggaacacaaaaaccaaagttaaagtgaaagtgaatgtgaatgtgaaagtgtgcccgaaagtttctggccaaggcggaagtcattaacgtgtgttcg

PCR verification status

Line verified as correct.

No slide loaded.