Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT50230 chr3R 26821511–26823616 (2105 bp) 5-HT7, CG31007 activityactivityactivityactivityactivityactivity
active
procephalic ectoderm AISN, anterior endoderm AISN, midgut interstitial cell VDRC

Annotations

stageannotation termintensity
4-6dorsal ectoderm AISN subset3
4-6procephalic ectoderm AISN4
4-6anterior endoderm AISN4
7-8not active0
9-10not active0
11-12not active0
13-14head subset2
13-14midgut interstitial cell4
13-14midgut subset4
15-16head subset3
15-16midgut chamber3
15-16midgut interstitial cell3

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn00045735-HT7overlapping BDGP FlyBase iFly
FBgn0051007CG310073333bp downstream BDGP FlyBase
FBgn0051008CG310085784bp downstream BDGP FlyBase
FBgn0062411Ctr1C31470bp downstream BDGP FlyBase
FBgn0039812CG1554833483bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tgaacctgcacggattattggcattaagtaagccagccagataattatgcaaatttcagattcagcttcagccattttggagctccaccattaaagacctgctttttggccaacaccccaactaattgcccaacgtcggctacaaattcctcactcgattgtctgcagaaaacaaattgcgcctggcaaataaataatgcatggttaaagcgacggggattcaggggtaacatgcaaatgatggcgggctctttctacctgcaaatcactttgagttattgtatttagccttcaacgtttcccggcaaagtagaataaatattttaaagcctcgcgccgtctcacctgcaaaaggtgtccaacagccacgcactttgggcgatgattgatatggctttttgggggaaatggaagacggtcggctcccgggggacgacaattccccttttcaaacacagaaaacgtcgagtgtcaaagtttttgtgcgcgcttagcgcatttgatgaattgttaaaagaaaatcgcgcgtatgtgtaaacattctggtctagaaattcgaaggggctggaaccttatgaatgtgtgtgtgaaaatcaactgtactaccaccagccgctatgggggaaaaagtctggcgaagcttttgaagccgccgacgagcaaatggcggaagcccaaacagctgctgatgatgatggcggttgctgtcggtaaacagaaagaaatgagtgggtaacattgcgggagcactgactggttaataccctttgtccgcaggcatcgaagattacccacaaatgtcaacaaaataaattcgacgacatttaagcccagcgagtgttatttgaaggttgctaattgagttaccctactctcccattcatcaggtaagcactttaaataattaaatggccaattgctggcacgcgagtggacaaaggtctttcattacttttaataatttagtattttagcagctttagccaactggaatcaagtagattaaacagccattgggaaatgacgtgacatttacccaatgaatatgaaatataaatacttatacactcaatcggagctaaatttaaagccaagaaaattgcttgtgtaaagattggaactgacaagtttccggattaaaataagtagagcaggtgaatcattgccaaagttcttgtgagttttaccttggcaaatcctaaggtaattttcgtaatgagtcactcgcccagacatttctatgctaatgcagctaaaattagcatgaaatgtgtatttacttagtgctggtcataggattatttgtggctcagtaagggtatgcccattcagatagcaggaagcaaaacttttcgcaggcccttcacttttaatctgccttagaccgaccaatacacacacacgagcctgggcaaatgaatatatgcatatgtgggctgtcattgccttaaagagacaggatccccgggattcctggtatttgcttggattctgcgtgggcacctaatcctcgccagagaagccacatttggctgggcgggaaatggagcgacactatacacatcaaatcatcaatcacatgctttggtgattcattgataagccctccccatcgaagccctccaaggactccgcatgcggtcctcgtggcaatcatgttaataatgccgcaagatgtcggccagccattagccttcgccattaggccctccactctcccctttccaccttcccacctattccatttccctttcccttttctgacggcaattaatttaaagagctttaaagcaagagaaatgaaatgcagagaatgggactttgtttattttgattttggaaatcaattttgaatttgttgtttatttttgatgtggttatccggccagcagccactggcgtgtaaacaaatcgagcgctttttttcgcagatgccacgaacagacaggctctgctttttgtgtgtttgtgcgtgcctcgcggaatatatataaatataaaaactatataaaaggcaaatattcatgcggaaaatatacgtatgtatgtatgctgcgtattcgtatatatcatgaagccgcgtatgtgtgtgtgcctgcgccatta

PCR verification status

Line verified as correct.

No slide loaded.