Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT50660 chr3R 27646409–27648516 (2107 bp) RhoGAP100F, FeCH activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0039883RhoGAP100Foverlapping BDGP FlyBase
FBgn0266268FeCH8392bp downstream BDGP FlyBase
FBgn0039882CG1157610502bp downstream BDGP FlyBase
FBgn0039881CG197113919bp downstream BDGP FlyBase
FBgn0250755CG4223315532bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

gcgaaaagtgtccaactaggaaaaccaatattccgaagtcaaatatattattcgatttgtatgcccacttttctcacagtgccgtcgtcgtcacggatacatcgcagaggtagaaagttttgcccaagacaaacactgccacagcatttctctccccattgtcttccggccaactgctcccgatattcttttgcgatttcttttgccattttgttgcagcttgctggctcgactaccgcgcccgggaacagcgtttgctgcacctcctggaatcccacatcccattctattgtttttgttgccaaatgattttgaaaaaagaacaagctaaaactattaattggcaacgcaggtgtagcggttttctaattgctgccaacgcagcgctaaaactttttctctcttggagcttaataatcttaattttgggtgcattgacttggaaagagctctgatagagccaagtagctcggaagctcgtccctttaggcatccagcttactgttcgcggaataatttgatgtgtaccaattttaaagccaatatggtagctcgcagttgtccgctatatctatcacagcaacttacattgagcaaacggcatttaaccacaagcaattaactaattgattaatcagcgagttaagaagcaaccgtatttgggcgaaagcaagctaagattccttccgcttttcacccgctgcacaacgcgtgccaactggcccaaagatgggttccgaggctcgcaagccttaccttgttggggaagcttacgtgcctcaaaatcctgtccatacttcttctgctcgactggcttcagctatgtacgtgcccttcatttgcgcaactaattgcaaaagtcttacgcaactacgggagacagtcgtcagtagtgagtgtcgacgggcgacgtattgaaatgttgtcgtgtttatcgaagagtcgagtttgttgcgtgcacgtaaaatatttgcctgtcactgggccgctctttcccatcgggggactgtcgaacgtgtttatattttgtagccggccgaaccatgttcaatcctcttgacagttgacttattgccgggatccaagcaccaaggtctacggatccgggggtcataccttgggatcgctcttaactaatttttaattattgccgtcggccgggcggcccattaaaatgatgagcgggattagaccagcccccttgtaatgctaatgggctgcccatcggctgagctgagctaaacgctgctctgctttttgtgttttctgctcttggcctggctggctgactttcgtgggtttcggctggcgtttaagtggcaatgctgcgtatgacacaatttatttttgggccatgaaaacatcagcttctcgccgagctgcgagcatctgtgtgcggaggaaattgaggacacttttttgcaagcaaagttgcatagttgccaaagagtgatggatgcactgagaaaagcatttggagttaacattttagtttaaatccttaaatttgttgctatgctatattttcaagccgagctaagcaaaagatacaacttgacatggccgatcgatttgaattacgttcttgatattctaatatgagtggacgaatccgagatcgaatctggacagctgcagaaagtgcagtcctaaaacgaaattaacccacggcctgcagtcgtactgaaggcaacatccacgcacacatccacatcacgacgccagtgcgctagtgtgcgtgggtatctgtgtgcgcactaaaagcggtttatgccactcacatgtaaacccagttgcctgccaagtgtttggctgtttggattcaacacccacacacgattgttgtgtggataggtcgtggctttgcgtgtttcaagcaactgagccacccactcggccacctagcagccccattctcctgtgggctgctcaaattttctgtttgctttgctgtggatttcgctacgtttcggcggaattccccctgccagcgtcatcagcccaactttttacttttcgtaccttaaacgtattttgcatttgcttggcacagatccgaaggggttggtgggttaaggttggcgggtgggctttggcattttctctct

PCR verification status

Line verified as correct.

No slide loaded.