Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT6169 chr2L 12088676–12090844 (2168 bp) CR44593, CR44592 activityactivityactivityactivityactivityactivity
active
anterior, A-P stripe, head epidermis ventral anlage VDRC

Annotations

stageannotation termintensity
4-6anterior4
4-6A-P stripe4
7-8not active0
9-10head epidermis ventral anlage3
11-12antenno-maxillary-labial complex3
11-12head epidermis lateral primordium subset3
13-14antenno-maxillary-labial complex3
13-14head subset3
15-16antenno-maxillary-labial complex2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0265804CR44593652bp downstream BDGP FlyBase
FBgn0265803CR445922264bp downstream BDGP FlyBase
FBgn0003145prd2850bp downstream BDGP FlyBase iFly
FBgn0032407Pex193146bp upstream BDGP FlyBase
FBgn0265805CR445943333bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tttccatgtccacagcccacagaaggctctgaccgacgaacgcactacgggatgcttagataatggactatttagagccatgatttccagaaattagggaattctggaaggcatatcgtaatacaccgtggcaagcaacatctttagacatcgtatattatacttagttagcaaatctaagtacttagattctaaagaaatagcactatttatttagctacaggcctactaaagatattttaaggaaaagcaaacatttcaacttttctaataatccttgtttttggtttaatgtagtattatatacaatttaattgattttcaataccttcatttagctatgtttctagctgaaatcttaagccccctgttgatcctgcgcttctgcgctgatcctcaaatatttccactcgctcgacagactggcaggcggcgattgactttttcctaatccgcagtaagttttagtaaatatgagtcgcattctatcccgtggtccattccatcctatcccatctgagctgaatctcccagagcgagtcctttcgcaggagtcctgtgaccggagcgatcgtaaatcgcaatccccgctaaagcatgcaaacaaatagcggcaaagtgcgagattagagggaaagtcgcagcagcttagatcctggatcctggccagcctgtgtcctggatcccgtcgatcgccagttgactttttcaaatattttggaaaagttctcgagtgttgatcgcccgattatagcggataatcgcattacagcccgacgttttattgatcaacaattgtaaacgatttgccatggcccatggcaatctgggtgggtcaggacgagtcgggccaactcggagtccatgtccaggtagttatcgaaaaaatgctgcggcttaacgcagcccacgcccactctacgacaaaaagtgggcggaaagctgagggcctttcccgatctccgggcgattaacccttgctcttggtagcagtttagccgggctaattgaaggcattagttgtttgtgggtcgcgagctggcttccccggaactccattgtccttaaattagcatctctcatagcatatataccttcgatcgcaattggtggaaacttcgcgcctctgcccacaaacgtttggttttggcactccaaccacatgacattcgtcatgcactcagcgaaaatacttagcaaatgttgttcatgcaaagaaatattcatattctgtataattattgcttaagaatatatatttttcagtacctaaatgtataagaatgaagaagctataaattaaataataaatagttagttagttgaaagggattatcttcctgtgtattgggacgtcacagagtctggctgaattttcgccgatcatgtaggaagtgtcccaggggcaaaaaggggagcccctgccacatacacccactttcgagaaactcattagcctggggcacaacaaacccggcaactcggggcacaaacaaaccaatcccgagcccaatcgactgctaaacgctgtcggcacacatctgagagacggcgacggaggccaacaaattgatcattaaacagaaggcgcaaatgtaggcgcaacccatcgttgtccaacagaagatcgtagcatcggagcatcaggtcgagatcaaacacctgggccctcgacctggcgaagaaagtgacgaggctgcgacgtcaacaagattaatttgttttccggccgggttccatctccatccagagtcacagagccacatccacatccatatttcccaactcagccggcaacctgttgtccagttccccgatttgtaattgccctgctttgtggtagtcgatcaggttcgatcgcggatcgatcatatactctactataatggacaaactcgatggatggcgaaagaacatcattagttttctcggcgtagagtccacaaagtaggtggcgtttttctcacatcccgagtgtttctatggaatctcgatttggagatgttggatcttctcttcggcggcgtttgtccattagccacggtttgcatcggatatatgcgaatttaaataaaatcattcaattgtttcattaatcactggctacggtcggcgttttctattaaaaaaaatgcattgccaatggaaaaattgactgcagagaccgtg

PCR verification status

Line verified as correct.

No slide loaded.