Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT7402 chr2L 14485084–14487223 (2139 bp) CR44731, noc activityactivityactivityactivityactivityactivity
active
A-P stripes, pair rule, ventral nerve cord primordium subset VDRC

Annotations

stageannotation termintensity
4-6A-P stripes5
4-6pair rule5
7-8ventral ectoderm anlage3
7-8posterior endoderm anlage3
9-10ventral nerve cord anlage subset3
11-12ventral nerve cord primordium subset4
13-14ventral nerve cord subset2
15-16head epidermis lateral subset2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0265944CR44731956bp upstream BDGP FlyBase
FBgn0005771noc5775bp upstream BDGP FlyBase
FBgn0028882tRNA:P:35Bd10794bp upstream BDGP FlyBase
FBgn0265943CR4473027747bp downstream BDGP FlyBase
FBgn0011862tRNA:G3:35Ba33007bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

ccagaaagatccatccgaagcacaagagatatatatgcatgtataaacgtataaaccaaccgaccgacagacgtcgccgacccacacactatttaatttagtacaaaattattatgcgcaacattagcactcgtctcggtttgcctgggttttcctctcggcttgggtttttatcgagtctgggttttgggcatgggtcttttctcgagttcggagcgtgaggtgcctcaaatgaggtgtgaatttcgctgtcagcccgtcattctcaacggactgaggagaacacacaaaagtgccgacattggtgcttcttctgtgtcggttttgaatttatgttaatacagtcgcgctttgaagccagcgtaacgttgagcatcgcaattgtctcaataccctcggagtattcaaattaatcggcatagtctcttataataaatagcagtgcgcatctgcaagtctgaaaacatattaaacacccaaaagttcattcattattaataatctttttcccttttttccgtaccttggctcacatggatctattataaaacaatgcatcataagctgtgctcttacgttacggtttgtctaaaaatatgtattcacaacgcttgccattccatatatcataatcgaacagaacgagcagaggaaaacatttgcaaggcacccagcgagcatcagcagaacaacaaacaaaatatttatggccaaacataaaaatctttatgaccttcccgattcaatcagagcagagctggagctgggcgagcacaacaactgagccaggtcccaatgcgactacagctacaacgactggcgcttcctggcgaacacaggatatagccatccataaggtgtttccccccggccaactcgccctgccgccctgccgcccatgtgtgttcgccttgataaagagaacgtaaattatggccctatatatcatgggaaatctatcgacaacgttgaatttttatggtctccgaaggaacggcgcagtttaacgagccggcgagagtctggccatgtttattgatttactcgctaatttttcagctccggcaaagacggccgaggagtgcggtcaatcaaggacatccgaggactggcccgggctgagatgagagtcgatcgcggcaggcaggccattgtccttgatttatggtccgtcattcattgccagccaccaaagttgacacttctgcgtatatcccggagttcgtcctgccattgtcatccagtcactcccctcgatgtcgtcgtcctgcgtccttcgacgtccctcccgttgcgctcatcctgacattttgacaaataattttattgatgctctgttcctcgccgtctgtgtttggtttttaattgtcgctcagctgcgctggacgcacgtgataattgctcattttatgacgcatttatcaaatgctcggccttggtctcgtccttggcattggcatcggcatcggcattcggaatgtcctttgttcggtggtgattttctgcatcatgctgcgtctgacagttggactagcgtactcctcctgttcctcttctaccttccccttcaatcctccgcagatgagacagtcacgcgtcatttatttggccgtgacatttccactccgggttgccattttgcattcgcgggaattaggaatggatttggaaaaactgtccgaactcttcggttcaagtacattcaattctgcattcagcagatggtgctatgagctatcaaaatcaataagctgtgaaactagatggaaattgtatgctttttaaaatattattaatgtaaaggttatttgtataaagacaaatatttaccattcctagaactttcttcatcatccgtacaacttttaaaatctatatttccttcgaataaataatctattctcatagatgaacttttcgtgatttatttgttggattaaacctttatcaataaccgccgtatatcaacaggacatctccgccctctggacccacagccgtcagatcggatgttgtaggcaattaatacttaatacccaaaatggcaataaaaattgatgccatcaatttatcattttagaatcctgcacgtgtcaactcgtaggtatttccactttttgtgtgtgtgtccattgttcca

PCR verification status

Line verified as correct.

No slide loaded.