Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT8145 chr2L 15936129–15938288 (2159 bp) beat-Ib, CG12448 activityactivityactivityactivityactivityactivity
active
fat body VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14fat body3
15-16fat body2

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0028645beat-Iboverlapping BDGP FlyBase
FBgn0028857CG124485312bp upstream BDGP FlyBase
FBgn0028514CG47939843bp downstream BDGP FlyBase
FBgn0032577CG1324418523bp downstream BDGP FlyBase
FBgn0028856CG1806321729bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tcgatcttattttctgtcttttaattgcgttgataacaaaattttaagtactaagctcaagaaatacattttataaatgaggttcgtgccttaaataatctttatattgaagctatttttagagataagcatttctggcatctgacctacttaatatgcccaagggaagccacacattttaaatcaattacgaatatgctacgttccatctttcaatcaatcaaagtgaattggttgccgtggcttgttttttcccgctcacttaatattgaatgccatcaataacaataattttcataaatatgataagacataaatcacaaagtagcaggcgccacaaagtgcctggccaagggtctggatttaggtccccctcccgacaggaccatcagtcggggtcaccacccatcgtctgcactgtcacttggtcatgcgaggcacgcgcttctctcagaacgacacaaaaagcggaaaaaataaggagaagagccaactttcaaaacccgaaactttcataccctggcattaatagaatactattgactagtcgaccaataaagtgcgatgtatgcataaaagacctttacttaaaagttttaagctttaagttttactaaattttaaatcgtgtgaaaaaagagtgcatattatgtattgttgttgcctttaaaatattagataatattaagtgcgtctatctatcctggtttcttgggcaaatcttcacatacagaacttcccgtatttagaatgctcttgaatacaagatgcctttgcatttaagataaaaaatgcataaacaggtgctaaatagccatatatatatcagattaacattacaataccctttgctagggcataaaaagagcagctaagcagggaccgcccagttagaggcgatgggtgggggttggttagcggcaggacgcggaaggacgcggcaacgtcacgcggcgttgtcatggcgcaataaaaataaaaatctaattagtatgccgttgacagtttaatcgtgattacgctggcaaaaatgtcagctaagcgtggcagaagcggtgggtggcgcttgccagtgggtgttgggcggccgttggatgatgggtggtagtgggagtgggagtggcaaagcgtcaacatcaacatgccaacagttgattcctggcattgttgttcctgctcttggacgttgagcttggcatttccggcagacgccacatgcatcgcgtgcgtgtcacaacaacaagtgtgtgtgggctggcggacgtgtgtatatgtgagtgttatgtgcgggtgtcaaaagtttagcactgaaaattgcccgccagtccgttgctggtttcccgagtgggcggcagcaaaacgctatataaaaatataagaaataataagccatttctggtgcaaagggactagaagtgaactgaaatgcgagatgttgttcaatagttggtgaaaacatgccaaaattataaatatctttaaaaaaaattttcttattaaataaattcattgaaatgataaaaacgtacttataagagaaatgttataaaataaattattaaataatataatgcccatcaaaagttatgggttttcaaggattaacggtgataaggaataatatatatattccaaaacataatatataaatatatatgacccaagctctttccgtacaaccaaaaaatataagaataatattttcttaatgatctcattcaagtaaaagctagaaacggggtatcaaacgaatctcgctctgacgcttgtgggccttttatttttttggaaatatgctccacggccagacactctcttcctggaagccccccccccttaatgttggccattgaaatgcgtgtctagtgaaggatccgcgagacgtgattggaagtttttagcaggtcctgtcgccgtttcctctttgtttcgatggaatacgagtggttttgcaccagacgggtgggcgatggcacacgtctctttgccaaatgccagttagtacgttctggaggagggggaggcgtgtgactagcccgaattaagagcaagcaagaagtgcagatctagcccagaccggaaccggaagttgctgtgatgaattgctctgcatcgacagccgcttgcgtgcctttaaaggcggcttcccaagtacacttt

PCR verification status

Line verified as correct.

No slide loaded.