Fly Enhancers @ Stark Lab

ID Coordinates Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT9677 chr2L 18893565–18895695 (2130 bp) CR44737, CR44739 activityactivityactivityactivityactivityactivity
active
amnioserosa AISN, dorsal ectoderm AISN broad, dorsal ectoderm anlage broad VDRC

Annotations

stageannotation termintensity
4-6amnioserosa AISN4
4-6dorsal ectoderm AISN broad4
7-8dorsal ectoderm anlage broad4
7-8amnioserosa anlage4
9-10amnioserosa anlage3
11-12amnioserosa3
13-14trunk epidermis subset1
13-14head epidermis dorsal subset3
15-16head subset1

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0265950CR4473746bp upstream BDGP FlyBase
FBgn0265952CR447395999bp upstream BDGP FlyBase
FBgn0003896tup12305bp downstream BDGP FlyBase iFly
FBgn0265951CR4473812559bp upstream BDGP FlyBase
FBgn0032723ssp322782bp upstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

cccatttcaatgaacttttcgacaacgatgtttctctacatacacgcagccatttcattatgaatcaccgagaaaatcctcagaacaagttcgccaaacgatctcagacactttccctgctaaagaaacttttcacacacatcgcacggggaaagcccttaggaagctaagcattagaactgccattaaagtgtcttaacttttcaggggttcgttttgtttcagttcacgtttgtgccttactgatttcctctctgcctggtttttcctgcgcattttttccacattcccatttcaagtcattcgcagccatttcgagccttcgtacttgccgtactccggaatggagtacttggaatggaactccactcgaactaaactctggcagttacagggactttcctttgggttgggctctggtatttcagctctggggttagtaaatttatgatcctagtcgttgaaatgacgatgaactttttgctgcacacacgaacttggacttgggtcgccggtttttggttgttgcccggtttttatgcaccccgagtatcatctgcttaatcaccaaaaatagccaccatatggcactcgcccacagaaagggaaacacgacttcaaaggagtctctgctttttgcacgcactgtgtcggtgtgtttgtgtttaagtgtgtgtgtgagcctcaataatttattcatatgcgcttacaagtcactgatgttgttgctctgctccttcgacgcttgccgcagacaatttatgcacgcttttgcggaaaagccgcaggaaaatacacagtttttccgtacttccaattcgtagtttttcttacgccgtcgagtggtattttcaattctactagaagtttctaaggcgtagcttttcaagggagaagtttttgaaccctttgtgcaaaatgctcaaaccataaaaactacctcatttccttgcaatttaacttacattttaagtttcattttgtatttaagcaaccactgaaagtatttaatgttacaccaaatacccatcagtttgatttttgagcggtagctttggcccttctcagtttgaaggagaaatgcgtcgggctaagctgcttacagtgagctgtcgataagagtgcgagactgactgccagcagcgatcgctcatgtacgccataaatcataaagacgcgacctcggatcggtgtccccagccatacactcgcacatatatccaactccatggacaccgatctcgtctccgattcccattccgattctgccgccgtcgctggcctctaatgtgcttaaggaacgcttaaggttgtccgcacgtcaggaattcgcgtcccgaactgataagagacgagtcgtcgctgccctacctggattccggcctgaatttgagttccagactccagactgcggcccagaacgaccatgcaataccagaagcccgaaatcaattgcgtatttattggtcacaatcaatgcggcgcgacaagcaatggtatacgcaaggagagggggtaagagatgatgcactgagggaaaaaagaagtatgaagatgcacactattacataacaaaatcgtaggtacgaaatcataaaggtaattatttttatgtctctatttcatctataaaatatttacatattaacaatatatactatttccatgttcacaaacattagatgatttatgggatcaatttactacccagcccatcattcgtgggcttaagtgcctggactatttttcaccgtgtaaggaaagagagcaactgaccgtggaacgatcgcttaatgatcgcccaccgcgtcgccgtcaacgtcaaccgcaataagccggcggcgtcagcagagaagcgcacccacttcattacctctcctggagaggattgcctgtccagcggtcgcatcttcttcttcgtttggcttctcggttgcgtcatggctgtggaatgccagcccctataatggtgtacctcctggccgattccctacctgacctgttgtccgcgtgtctctccaggcgtaatcagttataaatcacccgtctaggaagtgcctgtgtttcctgttcccagtttatggtcctgccaaaatccgaggaagggtaagtggtaggggttggtcctggc

PCR verification status

Line verified as correct.

No slide loaded.