ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT0016 | chr2L 34214–34809 (595 bp) | Cda5, Ir21a |
not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0051973 | Cda5 | overlapping | BDGP FlyBase |
FBgn0031209 | Ir21a | 9060bp downstream | BDGP FlyBase |
FBgn0263584 | CR43609 | 9978bp downstream | BDGP FlyBase |
FBgn0002121 | l(2)gl | 12839bp downstream | BDGP FlyBase iFly |
FBgn0031208 | CG11023 | 24731bp downstream | BDGP FlyBase |
Sequence
gctggcgttgttagagtgagtgtgctcgagtggctggctcgggtatccagtttttgtatggccacatgttctgccctgatagataaatgtattgtggtttggtgtatacgtattggcttggtggttgtgtaaaaattttgatgcatgtgtagtgagaatatgaagttttacacttgttagggttctaactagttttgcgggatacttcttattgcaggaacttttcatgcttgcaaggctgactgtttttctgggattgagttttttcgtggatgatctcttttaaaatgctttttaaattaacgaatgccgtggcttcaaagcatttaaatggaattacttacctttgaggagtacgtgttggatgatcgtacgcattatcctgttcaatctaaaattatgggtaaacataaaattcgtagtatttaaatatatatatagtttgtgaaaagaaacggtatttaaaagttacaatatgagaaatactaatatagatttttctgtacctggctattaatatcctcatcgtagtctgtattgtacgctggctggttttcgtaagaggggggcttcggagtggcgggaagctctaaggg
PCR verification status
Line was not verified.
No slide loaded.