Fly Enhancers @ Stark Lab

ID Coordinates* Neighboring genes Expression
(4–6, 7–8, 9–10, 11–12, 13–14, 15–16)
Strongest annotations Order
VT0129 chr2L 283242–283450 (208 bp) CG11601, CG3625 activityactivityactivityactivityactivityactivity
not active
VDRC

Annotations

stageannotation termintensity
4-6not active0
7-8not active0
9-10not active0
11-12not active0
13-14not active0
15-16not active0

Whole-slide images

Please, be patient. The images might load slowly.

Neighboring genes

gene IDgene namedistancelinks
FBgn0031244CG11601overlapping BDGP FlyBase
FBgn0031245CG3625143bp upstream BDGP FlyBase
FBgn0003444smo1076bp downstream BDGP FlyBase iFly
FBgn0025686Amnionless4010bp upstream BDGP FlyBase
FBgn0086855CG170785009bp downstream BDGP FlyBase

UCSC snapshot

UCSC snapshot

Sequence

tttcattccagcaaggaggcgtttttaagctagaactagctttttaaagccaaatcgatatgatagcgccacttgacgtttctctgatcttgaaaagcagtttattccaagcttcccaccttaaaacagttttcgcagctgatgaagagtttaatcgctttattatggtactagaattgaataacagtggtattcaaagatggcgttga

PCR verification status

Line was not verified.

No slide loaded.