ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
---|---|---|---|---|---|
VT0129 | chr2L 283242–283450 (208 bp) | CG11601, CG3625 |
![]() ![]() ![]() ![]() ![]() ![]() not active |
VDRC |
Annotations
stage | annotation term | intensity |
---|---|---|
4-6 | not active | 0 |
7-8 | not active | 0 |
9-10 | not active | 0 |
11-12 | not active | 0 |
13-14 | not active | 0 |
15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
gene ID | gene name | distance | links |
---|---|---|---|
FBgn0031244 | CG11601 | overlapping | BDGP FlyBase |
FBgn0031245 | CG3625 | 143bp upstream | BDGP FlyBase |
FBgn0003444 | smo | 1076bp downstream | BDGP FlyBase iFly |
FBgn0025686 | Amnionless | 4010bp upstream | BDGP FlyBase |
FBgn0086855 | CG17078 | 5009bp downstream | BDGP FlyBase |
Sequence
tttcattccagcaaggaggcgtttttaagctagaactagctttttaaagccaaatcgatatgatagcgccacttgacgtttctctgatcttgaaaagcagtttattccaagcttcccaccttaaaacagttttcgcagctgatgaagagtttaatcgctttattatggtactagaattgaataacagtggtattcaaagatggcgttga
PCR verification status
Line was not verified.
No slide loaded.