| ID | Coordinates* | Neighboring genes | Expression (4–6, 7–8, 9–10, 11–12, 13–14, 15–16) |
Strongest annotations | Order |
|---|---|---|---|---|---|
| VT0249 | chr2L 544170–544616 (446 bp) | Spp, Ets21C |
not active |
VDRC |
Annotations
| stage | annotation term | intensity |
|---|---|---|
| 4-6 | not active | 0 |
| 7-8 | not active | 0 |
| 9-10 | not active | 0 |
| 11-12 | not active | 0 |
| 13-14 | not active | 0 |
| 15-16 | not active | 0 |
Whole-slide images
Please, be patient. The images might load slowly.
Neighboring genes
| gene ID | gene name | distance | links |
|---|---|---|---|
| FBgn0031260 | Spp | overlapping | BDGP FlyBase |
| FBgn0005660 | Ets21C | 755bp upstream | BDGP FlyBase |
| FBgn0031261 | nAChRbeta3 | 959bp upstream | BDGP FlyBase |
| FBgn0010602 | lwr | 1591bp downstream | BDGP FlyBase iFly |
| FBgn0003963 | ush | 3611bp downstream | BDGP FlyBase iFly |
Sequence
tgaagaacaggtacagcccgaagagggctgccgacgcgatcagcgggaagtacatggcgtctttcttggtcatcgtgtccgccttctcgcccgttgactgcagggagtgggaattacgggaaacatgttaatgcagcttccgggctgagtctgcttcacataccttcttcagcttgtgcagcttcacggagcggatggagccgaagatgatgggcagcatggccatcaccaccaggctgctgtaggccaccgccatgccctccggagtcgagggcttcttctcgcccggcgccgactcgttcttcggcgcgttcacattctcgatgatgcccttcagcacctccttaacggttccgatgacttcctccgccatgctgtgctgtccaatccaatccgttcctgaaaatcgccggcttgcgggggtgaaaagcgaaatgacacgcagca
PCR verification status
Line verified as correct.
No slide loaded.